mirror of
https://github.com/golang/go
synced 2024-11-15 10:50:37 -07:00
6e8875551a
I have included a few important microbenchmarks, but the overall intent is to have mostly end-to-end benchmarks timing real world operations. The jsondata.go file is a summary of agl's activity in various open source repositories. It gets used as test data for many of the benchmarks. Everything links into one binary (even the test data) so that it is easy to run the benchmarks on many computers: there is just one file to copy around. R=golang-dev, r, bradfitz, adg, r CC=golang-dev https://golang.org/cl/5484071
165 lines
3.3 KiB
Go
165 lines
3.3 KiB
Go
// Copyright 2011 The Go Authors. All rights reserved.
|
|
// Use of this source code is governed by a BSD-style
|
|
// license that can be found in the LICENSE file.
|
|
|
|
package go1
|
|
|
|
// Not a benchmark; input for revcomp.
|
|
|
|
var fasta25m = fasta(25e6)
|
|
|
|
func fasta(n int) []byte {
|
|
out := make(fastaBuffer, 0, 11*n)
|
|
|
|
iub := []fastaAcid{
|
|
{prob: 0.27, sym: 'a'},
|
|
{prob: 0.12, sym: 'c'},
|
|
{prob: 0.12, sym: 'g'},
|
|
{prob: 0.27, sym: 't'},
|
|
{prob: 0.02, sym: 'B'},
|
|
{prob: 0.02, sym: 'D'},
|
|
{prob: 0.02, sym: 'H'},
|
|
{prob: 0.02, sym: 'K'},
|
|
{prob: 0.02, sym: 'M'},
|
|
{prob: 0.02, sym: 'N'},
|
|
{prob: 0.02, sym: 'R'},
|
|
{prob: 0.02, sym: 'S'},
|
|
{prob: 0.02, sym: 'V'},
|
|
{prob: 0.02, sym: 'W'},
|
|
{prob: 0.02, sym: 'Y'},
|
|
}
|
|
|
|
homosapiens := []fastaAcid{
|
|
{prob: 0.3029549426680, sym: 'a'},
|
|
{prob: 0.1979883004921, sym: 'c'},
|
|
{prob: 0.1975473066391, sym: 'g'},
|
|
{prob: 0.3015094502008, sym: 't'},
|
|
}
|
|
|
|
alu := []byte(
|
|
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
|
|
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
|
|
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
|
|
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
|
|
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
|
|
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
|
|
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA")
|
|
|
|
out.WriteString(">ONE Homo sapiens alu\n")
|
|
fastaRepeat(&out, alu, 2*n)
|
|
out.WriteString(">TWO IUB ambiguity codes\n")
|
|
fastaRandom(&out, iub, 3*n)
|
|
out.WriteString(">THREE Homo sapiens frequency\n")
|
|
fastaRandom(&out, homosapiens, 5*n)
|
|
return out
|
|
}
|
|
|
|
type fastaBuffer []byte
|
|
|
|
func (b *fastaBuffer) Flush() {
|
|
panic("flush")
|
|
}
|
|
|
|
func (b *fastaBuffer) WriteString(s string) {
|
|
p := b.NextWrite(len(s))
|
|
copy(p, s)
|
|
}
|
|
|
|
func (b *fastaBuffer) NextWrite(n int) []byte {
|
|
p := *b
|
|
if len(p)+n > cap(p) {
|
|
b.Flush()
|
|
p = *b
|
|
}
|
|
out := p[len(p) : len(p)+n]
|
|
*b = p[:len(p)+n]
|
|
return out
|
|
}
|
|
|
|
const fastaLine = 60
|
|
|
|
func fastaRepeat(out *fastaBuffer, alu []byte, n int) {
|
|
buf := append(alu, alu...)
|
|
off := 0
|
|
for n > 0 {
|
|
m := n
|
|
if m > fastaLine {
|
|
m = fastaLine
|
|
}
|
|
buf1 := out.NextWrite(m + 1)
|
|
copy(buf1, buf[off:])
|
|
buf1[m] = '\n'
|
|
if off += m; off >= len(alu) {
|
|
off -= len(alu)
|
|
}
|
|
n -= m
|
|
}
|
|
}
|
|
|
|
const (
|
|
fastaLookupSize = 4096
|
|
fastaLookupScale float64 = fastaLookupSize - 1
|
|
)
|
|
|
|
var fastaRand uint32 = 42
|
|
|
|
type fastaAcid struct {
|
|
sym byte
|
|
prob float64
|
|
cprob float64
|
|
next *fastaAcid
|
|
}
|
|
|
|
func fastaComputeLookup(acid []fastaAcid) *[fastaLookupSize]*fastaAcid {
|
|
var lookup [fastaLookupSize]*fastaAcid
|
|
var p float64
|
|
for i := range acid {
|
|
p += acid[i].prob
|
|
acid[i].cprob = p * fastaLookupScale
|
|
if i > 0 {
|
|
acid[i-1].next = &acid[i]
|
|
}
|
|
}
|
|
acid[len(acid)-1].cprob = 1.0 * fastaLookupScale
|
|
|
|
j := 0
|
|
for i := range lookup {
|
|
for acid[j].cprob < float64(i) {
|
|
j++
|
|
}
|
|
lookup[i] = &acid[j]
|
|
}
|
|
|
|
return &lookup
|
|
}
|
|
|
|
func fastaRandom(out *fastaBuffer, acid []fastaAcid, n int) {
|
|
const (
|
|
IM = 139968
|
|
IA = 3877
|
|
IC = 29573
|
|
)
|
|
lookup := fastaComputeLookup(acid)
|
|
for n > 0 {
|
|
m := n
|
|
if m > fastaLine {
|
|
m = fastaLine
|
|
}
|
|
buf := out.NextWrite(m + 1)
|
|
f := fastaLookupScale / IM
|
|
myrand := fastaRand
|
|
for i := 0; i < m; i++ {
|
|
myrand = (myrand*IA + IC) % IM
|
|
r := float64(int(myrand)) * f
|
|
a := lookup[int(r)]
|
|
for a.cprob < r {
|
|
a = a.next
|
|
}
|
|
buf[i] = a.sym
|
|
}
|
|
fastaRand = myrand
|
|
buf[m] = '\n'
|
|
n -= m
|
|
}
|
|
}
|