1
0
mirror of https://github.com/golang/go synced 2024-11-19 23:44:43 -07:00
go/test/bench/go1/fasta_test.go
Russ Cox 6e8875551a test/bench/go1: first draft of Go 1 benchmark suite
I have included a few important microbenchmarks,
but the overall intent is to have mostly end-to-end
benchmarks timing real world operations.

The jsondata.go file is a summary of agl's
activity in various open source repositories.
It gets used as test data for many of the benchmarks.

Everything links into one binary (even the test data)
so that it is easy to run the benchmarks on many
computers: there is just one file to copy around.

R=golang-dev, r, bradfitz, adg, r
CC=golang-dev
https://golang.org/cl/5484071
2011-12-15 12:32:59 -05:00

165 lines
3.3 KiB
Go

// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
package go1
// Not a benchmark; input for revcomp.
var fasta25m = fasta(25e6)
func fasta(n int) []byte {
out := make(fastaBuffer, 0, 11*n)
iub := []fastaAcid{
{prob: 0.27, sym: 'a'},
{prob: 0.12, sym: 'c'},
{prob: 0.12, sym: 'g'},
{prob: 0.27, sym: 't'},
{prob: 0.02, sym: 'B'},
{prob: 0.02, sym: 'D'},
{prob: 0.02, sym: 'H'},
{prob: 0.02, sym: 'K'},
{prob: 0.02, sym: 'M'},
{prob: 0.02, sym: 'N'},
{prob: 0.02, sym: 'R'},
{prob: 0.02, sym: 'S'},
{prob: 0.02, sym: 'V'},
{prob: 0.02, sym: 'W'},
{prob: 0.02, sym: 'Y'},
}
homosapiens := []fastaAcid{
{prob: 0.3029549426680, sym: 'a'},
{prob: 0.1979883004921, sym: 'c'},
{prob: 0.1975473066391, sym: 'g'},
{prob: 0.3015094502008, sym: 't'},
}
alu := []byte(
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA")
out.WriteString(">ONE Homo sapiens alu\n")
fastaRepeat(&out, alu, 2*n)
out.WriteString(">TWO IUB ambiguity codes\n")
fastaRandom(&out, iub, 3*n)
out.WriteString(">THREE Homo sapiens frequency\n")
fastaRandom(&out, homosapiens, 5*n)
return out
}
type fastaBuffer []byte
func (b *fastaBuffer) Flush() {
panic("flush")
}
func (b *fastaBuffer) WriteString(s string) {
p := b.NextWrite(len(s))
copy(p, s)
}
func (b *fastaBuffer) NextWrite(n int) []byte {
p := *b
if len(p)+n > cap(p) {
b.Flush()
p = *b
}
out := p[len(p) : len(p)+n]
*b = p[:len(p)+n]
return out
}
const fastaLine = 60
func fastaRepeat(out *fastaBuffer, alu []byte, n int) {
buf := append(alu, alu...)
off := 0
for n > 0 {
m := n
if m > fastaLine {
m = fastaLine
}
buf1 := out.NextWrite(m + 1)
copy(buf1, buf[off:])
buf1[m] = '\n'
if off += m; off >= len(alu) {
off -= len(alu)
}
n -= m
}
}
const (
fastaLookupSize = 4096
fastaLookupScale float64 = fastaLookupSize - 1
)
var fastaRand uint32 = 42
type fastaAcid struct {
sym byte
prob float64
cprob float64
next *fastaAcid
}
func fastaComputeLookup(acid []fastaAcid) *[fastaLookupSize]*fastaAcid {
var lookup [fastaLookupSize]*fastaAcid
var p float64
for i := range acid {
p += acid[i].prob
acid[i].cprob = p * fastaLookupScale
if i > 0 {
acid[i-1].next = &acid[i]
}
}
acid[len(acid)-1].cprob = 1.0 * fastaLookupScale
j := 0
for i := range lookup {
for acid[j].cprob < float64(i) {
j++
}
lookup[i] = &acid[j]
}
return &lookup
}
func fastaRandom(out *fastaBuffer, acid []fastaAcid, n int) {
const (
IM = 139968
IA = 3877
IC = 29573
)
lookup := fastaComputeLookup(acid)
for n > 0 {
m := n
if m > fastaLine {
m = fastaLine
}
buf := out.NextWrite(m + 1)
f := fastaLookupScale / IM
myrand := fastaRand
for i := 0; i < m; i++ {
myrand = (myrand*IA + IC) % IM
r := float64(int(myrand)) * f
a := lookup[int(r)]
for a.cprob < r {
a = a.next
}
buf[i] = a.sym
}
fastaRand = myrand
buf[m] = '\n'
n -= m
}
}