qbit/go
1
0
Fork 0
mirror of https://github.com/golang/go synced 2024-11-12 04:00:23 -07:00
Code Releases Activity

remove bytes.Copy

Browse Source 
replace all calls with calls to copy
use copy in regexp and bytes.Buffer

R=rsc
CC=golang-dev
https://golang.org/cl/157073
This commit is contained in:
Rob Pike 2009-11-18 15:24:24 -08:00
parent 093493c6a5
commit e70cedfaec
22 changed files with 147 additions and 218 deletions
Show Stats Download Patch File Download Diff File Expand all files Collapse all files

3
src/cmd/cgo/util.go
View File

@ -5,7 +5,6 @@
package main
import (
"bytes";
"exec";
"fmt";
"go/token";
@ -20,7 +19,7 @@ func (r ByteReaderAt) ReadAt(p []byte, off int64) (n int, err os.Error) {
if off >= int64(len(r)) || off < 0 {
return 0, os.EOF
}
return bytes.Copy(p, r[off:len(r)]), nil;
return copy(p, r[off:len(r)]), nil;
}
// run runs the command argv, feeding in stdin on standard input.

31
src/pkg/archive/tar/writer.go
View File

@ -8,7 +8,6 @@ package tar
// - catch more errors (no first header, write after close, etc.)
import (
"bytes";
"io";
"os";
"strconv";
@ -124,25 +123,25 @@ func (tw *Writer) WriteHeader(hdr *Header) os.Error {
s := slicer(header);
// TODO(dsymonds): handle names longer than 100 chars
bytes.Copy(s.next(100), strings.Bytes(hdr.Name));
copy(s.next(100), strings.Bytes(hdr.Name));
tw.octal(s.next(8), hdr.Mode); // 100:108
tw.numeric(s.next(8), hdr.Uid); // 108:116
tw.numeric(s.next(8), hdr.Gid); // 116:124
tw.numeric(s.next(12), hdr.Size); // 124:136
tw.numeric(s.next(12), hdr.Mtime); // 136:148
s.next(8); // chksum (148:156)
s.next(1)[0] = hdr.Typeflag; // 156:157
s.next(100); // linkname (157:257)
bytes.Copy(s.next(8), strings.Bytes("ustar\x0000")); // 257:265
tw.cString(s.next(32), hdr.Uname); // 265:297
tw.cString(s.next(32), hdr.Gname); // 297:329
tw.numeric(s.next(8), hdr.Devmajor); // 329:337
tw.numeric(s.next(8), hdr.Devminor); // 337:345
tw.octal(s.next(8), hdr.Mode); // 100:108
tw.numeric(s.next(8), hdr.Uid); // 108:116
tw.numeric(s.next(8), hdr.Gid); // 116:124
tw.numeric(s.next(12), hdr.Size); // 124:136
tw.numeric(s.next(12), hdr.Mtime); // 136:148
s.next(8); // chksum (148:156)
s.next(1)[0] = hdr.Typeflag; // 156:157
s.next(100); // linkname (157:257)
copy(s.next(8), strings.Bytes("ustar\x0000")); // 257:265
tw.cString(s.next(32), hdr.Uname); // 265:297
tw.cString(s.next(32), hdr.Gname); // 297:329
tw.numeric(s.next(8), hdr.Devmajor); // 329:337
tw.numeric(s.next(8), hdr.Devminor); // 337:345
// Use the GNU magic instead of POSIX magic if we used any GNU extensions.
if tw.usedBinary {
bytes.Copy(header[257:265], strings.Bytes("ustar \x00"))
copy(header[257:265], strings.Bytes("ustar \x00"))
}
// The chksum field is terminated by a NUL and a space.

7
src/pkg/bytes/buffer.go
View File

@ -20,10 +20,11 @@ func copyString(dst []byte, doff int, str string) {
// Copy from bytes to byte array at offset doff. Assume there's room.
func copyBytes(dst []byte, doff int, src []byte) {
for soff := 0; soff < len(src); soff++ {
dst[doff] = src[soff];
doff++;
if len(src) == 1 {
dst[doff] = src[0];
return;
}
copy(dst[doff:len(dst)], src);
}
// A Buffer is a variable-sized buffer of bytes

20
src/pkg/bytes/bytes.go
View File

@ -44,20 +44,6 @@ func Equal(a, b []byte) bool {
return true;
}
// Copy copies bytes from src to dst,
// stopping when either all of src has been copied
// or all of dst has been filled.
// It returns the number of bytes copied.
func Copy(dst, src []byte) int {
if len(src) > len(dst) {
src = src[0:len(dst)]
}
for i, x := range src {
dst[i] = x
}
return len(src);
}
// explode splits s into an array of UTF-8 sequences, one per Unicode character (still arrays of bytes),
// up to a maximum of n byte arrays. Invalid UTF-8 sequences are chopped into individual bytes.
func explode(s []byte, n int) [][]byte {
@ -315,10 +301,10 @@ func Add(s, t []byte) []byte {
s = s[0 : lens+lent]
} else {
news := make([]byte, lens+lent, resize(lens+lent));
Copy(news, s);
copy(news, s);
s = news;
}
Copy(s[lens:lens+lent], t);
copy(s[lens:lens+lent], t);
return s;
}
@ -331,7 +317,7 @@ func AddByte(s []byte, t byte) []byte {
s = s[0 : lens+1]
} else {
news := make([]byte, lens+1, resize(lens+1));
Copy(news, s);
copy(news, s);
s = news;
}
s[lens] = t;

30
src/pkg/bytes/bytes_test.go
View File

@ -172,36 +172,6 @@ func TestSplitAfter(t *testing.T) {
}
}
type CopyTest struct {
a string;
b string;
n int;
res string;
}
var copytests = []CopyTest{
CopyTest{"", "", 0, ""},
CopyTest{"a", "", 0, "a"},
CopyTest{"a", "a", 1, "a"},
CopyTest{"a", "b", 1, "b"},
CopyTest{"xyz", "abc", 3, "abc"},
CopyTest{"wxyz", "abc", 3, "abcz"},
CopyTest{"xyz", "abcd", 3, "abc"},
}
func TestCopy(t *testing.T) {
for i := 0; i < len(copytests); i++ {
tt := copytests[i];
dst := strings.Bytes(tt.a);
n := Copy(dst, strings.Bytes(tt.b));
result := string(dst);
if result != tt.res || n != tt.n {
t.Errorf(`Copy(%q, %q) = %d, %q; want %d, %q`, tt.a, tt.b, n, result, tt.n, tt.res);
continue;
}
}
}
// Test case for any function which accepts and returns a byte array.
// For ease of creation, we write the byte arrays as strings.
type StringTest struct {

5
src/pkg/compress/flate/deflate.go
View File

@ -5,7 +5,6 @@
package flate
import (
"bytes";
"io";
"math";
"os";
@ -128,7 +127,7 @@ func (d *deflater) fillWindow(index int) (int, os.Error) {
wSize := d.windowMask + 1;
if index >= wSize+wSize-(minMatchLength+maxMatchLength) {
// shift the window by wSize
bytes.Copy(d.window, d.window[wSize:2*wSize]);
copy(d.window, d.window[wSize:2*wSize]);
index -= wSize;
d.windowEnd -= wSize;
if d.blockStart >= wSize {
@ -355,7 +354,7 @@ func (d *deflater) doDeflate() (err os.Error) {
// For matches this long, we don't bother inserting each individual
// item into the table.
index += length;
hash = (int(d.window[index]) << hashShift + int(d.window[index+1]));
hash = (int(d.window[index])<<hashShift + int(d.window[index+1]));
}
if ti == maxFlateBlockTokens {
// The block includes the current character

7
src/pkg/crypto/rsa/pkcs1v15.go
View File

@ -6,7 +6,6 @@ package rsa
import (
"big";
"bytes";
"crypto/subtle";
"io";
"os";
@ -34,7 +33,7 @@ func EncryptPKCS1v15(rand io.Reader, pub *PublicKey, msg []byte) (out []byte, er
return
}
em[len(em)-len(msg)-1] = 0;
bytes.Copy(mm, msg);
copy(mm, msg);
m := new(big.Int).SetBytes(em);
c := encrypt(new(big.Int), pub, m);
@ -191,8 +190,8 @@ func SignPKCS1v15(rand io.Reader, priv *PrivateKey, hash PKCS1v15Hash, hashed []
for i := 2; i < k-tLen-1; i++ {
em[i] = 0xff
}
bytes.Copy(em[k-tLen:k-hashLen], prefix);
bytes.Copy(em[k-hashLen:k], hashed);
copy(em[k-tLen:k-hashLen], prefix);
copy(em[k-hashLen:k], hashed);
m := new(big.Int).SetBytes(em);
c, err := decrypt(rand, priv, m);

7
src/pkg/crypto/rsa/rsa.go
View File

@ -9,7 +9,6 @@ package rsa
import (
"big";
"bytes";
"crypto/subtle";
"hash";
"io";
@ -263,9 +262,9 @@ func EncryptOAEP(hash hash.Hash, rand io.Reader, pub *PublicKey, msg []byte, lab
seed := em[1 : 1+hash.Size()];
db := em[1+hash.Size() : len(em)];
bytes.Copy(db[0:hash.Size()], lHash);
copy(db[0:hash.Size()], lHash);
db[len(db)-len(msg)-1] = 1;
bytes.Copy(db[len(db)-len(msg):len(db)], msg);
copy(db[len(db)-len(msg):len(db)], msg);
_, err = io.ReadFull(rand, seed);
if err != nil {
@ -445,6 +444,6 @@ func leftPad(input []byte, size int) (out []byte) {
n = size
}
out = make([]byte, size);
bytes.Copy(out[len(out)-n:len(out)], input);
copy(out[len(out)-n:len(out)], input);
return;
}

7
src/pkg/crypto/subtle/constant_time_test.go
View File

@ -5,7 +5,6 @@
package subtle
import (
"bytes";
"testing";
"testing/quick";
)
@ -75,14 +74,14 @@ func TestConstantTimeEq(t *testing.T) {
}
}
func copy(v int, x, y []byte) []byte {
func makeCopy(v int, x, y []byte) []byte {
if len(x) > len(y) {
x = x[0:len(y)]
} else {
y = y[0:len(x)]
}
if v == 1 {
bytes.Copy(x, y)
copy(x, y)
}
return x;
}
@ -99,7 +98,7 @@ func constantTimeCopyWrapper(v int, x, y []byte) []byte {
}
func TestConstantTimeCopy(t *testing.T) {
err := quick.CheckEqual(constantTimeCopyWrapper, copy, nil);
err := quick.CheckEqual(constantTimeCopyWrapper, makeCopy, nil);
if err != nil {
t.Error(err)
}

20
src/pkg/crypto/tls/handshake_messages.go
View File

@ -4,10 +4,6 @@
package tls
import (
"bytes";
)
type clientHelloMsg struct {
raw []byte;
major, minor uint8;
@ -30,9 +26,9 @@ func (m *clientHelloMsg) marshal() []byte {
x[3] = uint8(length);
x[4] = m.major;
x[5] = m.minor;
bytes.Copy(x[6:38], m.random);
copy(x[6:38], m.random);
x[38] = uint8(len(m.sessionId));
bytes.Copy(x[39:39+len(m.sessionId)], m.sessionId);
copy(x[39:39+len(m.sessionId)], m.sessionId);
y := x[39+len(m.sessionId) : len(x)];
y[0] = uint8(len(m.cipherSuites) >> 7);
y[1] = uint8(len(m.cipherSuites) << 1);
@ -42,7 +38,7 @@ func (m *clientHelloMsg) marshal() []byte {
}
z := y[2+len(m.cipherSuites)*2 : len(y)];
z[0] = uint8(len(m.compressionMethods));
bytes.Copy(z[1:len(z)], m.compressionMethods);
copy(z[1:len(z)], m.compressionMethods);
m.raw = x;
return x;
@ -112,9 +108,9 @@ func (m *serverHelloMsg) marshal() []byte {
x[3] = uint8(length);
x[4] = m.major;
x[5] = m.minor;
bytes.Copy(x[6:38], m.random);
copy(x[6:38], m.random);
x[38] = uint8(len(m.sessionId));
bytes.Copy(x[39:39+len(m.sessionId)], m.sessionId);
copy(x[39:39+len(m.sessionId)], m.sessionId);
z := x[39+len(m.sessionId) : len(x)];
z[0] = uint8(m.cipherSuite >> 8);
z[1] = uint8(m.cipherSuite);
@ -156,7 +152,7 @@ func (m *certificateMsg) marshal() (x []byte) {
y[0] = uint8(len(slice) >> 16);
y[1] = uint8(len(slice) >> 8);
y[2] = uint8(len(slice));
bytes.Copy(y[3:len(y)], slice);
copy(y[3:len(y)], slice);
y = y[3+len(slice) : len(y)];
}
@ -189,7 +185,7 @@ func (m *clientKeyExchangeMsg) marshal() []byte {
x[3] = uint8(length);
x[4] = uint8(len(m.ciphertext) >> 8);
x[5] = uint8(len(m.ciphertext));
bytes.Copy(x[6:len(x)], m.ciphertext);
copy(x[6:len(x)], m.ciphertext);
m.raw = x;
return x;
@ -221,7 +217,7 @@ func (m *finishedMsg) marshal() (x []byte) {
x = make([]byte, 16);
x[0] = typeFinished;
x[3] = 12;
bytes.Copy(x[4:len(x)], m.verifyData);
copy(x[4:len(x)], m.verifyData);
m.raw = x;
return;
}

19
src/pkg/crypto/tls/prf.go
View File

@ -5,7 +5,6 @@
package tls
import (
"bytes";
"crypto/hmac";
"crypto/md5";
"crypto/sha1";
@ -37,7 +36,7 @@ func pHash(result, secret, seed []byte, hash hash.Hash) {
if j+todo > len(result) {
todo = len(result) - j
}
bytes.Copy(result[j:j+todo], b);
copy(result[j:j+todo], b);
j += todo;
h.Reset();
@ -52,8 +51,8 @@ func pRF11(result, secret, label, seed []byte) {
hashMD5 := md5.New();
labelAndSeed := make([]byte, len(label)+len(seed));
bytes.Copy(labelAndSeed, label);
bytes.Copy(labelAndSeed[len(label):len(labelAndSeed)], seed);
copy(labelAndSeed, label);
copy(labelAndSeed[len(label):len(labelAndSeed)], seed);
s1, s2 := splitPreMasterSecret(secret);
pHash(result, s1, labelAndSeed, hashMD5);
@ -81,13 +80,13 @@ var serverFinishedLabel = strings.Bytes("server finished")
// 4346, section 6.3.
func keysFromPreMasterSecret11(preMasterSecret, clientRandom, serverRandom []byte, macLen, keyLen int) (masterSecret, clientMAC, serverMAC, clientKey, serverKey []byte) {
var seed [tlsRandomLength * 2]byte;
bytes.Copy(seed[0:len(clientRandom)], clientRandom);
bytes.Copy(seed[len(clientRandom):len(seed)], serverRandom);
copy(seed[0:len(clientRandom)], clientRandom);
copy(seed[len(clientRandom):len(seed)], serverRandom);
masterSecret = make([]byte, masterSecretLength);
pRF11(masterSecret, preMasterSecret, masterSecretLabel, seed[0:len(seed)]);
bytes.Copy(seed[0:len(clientRandom)], serverRandom);
bytes.Copy(seed[len(serverRandom):len(seed)], clientRandom);
copy(seed[0:len(clientRandom)], serverRandom);
copy(seed[len(serverRandom):len(seed)], clientRandom);
n := 2*macLen + 2*keyLen;
keyMaterial := make([]byte, n);
@ -124,8 +123,8 @@ func (h finishedHash) Write(msg []byte) (n int, err os.Error) {
// message given the MD5 and SHA1 hashes of a set of handshake messages.
func finishedSum(md5, sha1, label, masterSecret []byte) []byte {
seed := make([]byte, len(md5)+len(sha1));
bytes.Copy(seed, md5);
bytes.Copy(seed[len(md5):len(seed)], sha1);
copy(seed, md5);
copy(seed[len(md5):len(seed)], sha1);
out := make([]byte, finishedVerifyLength);
pRF11(out, masterSecret, label, seed);
return out;

5
src/pkg/crypto/tls/record_process.go
View File

@ -10,7 +10,6 @@ package tls
// state, or for a notification when the state changes.
import (
"bytes";
"container/list";
"crypto/subtle";
"hash";
@ -228,8 +227,8 @@ func (p *recordProcessor) processHandshakeRecord(data []byte) {
return;
}
newBuf := make([]byte, len(p.handshakeBuf)+len(data));
bytes.Copy(newBuf, p.handshakeBuf);
bytes.Copy(newBuf[len(p.handshakeBuf):len(newBuf)], data);
copy(newBuf, p.handshakeBuf);
copy(newBuf[len(p.handshakeBuf):len(newBuf)], data);
p.handshakeBuf = newBuf;
}

3
src/pkg/crypto/tls/tls.go
View File

@ -6,7 +6,6 @@
package tls
import (
"bytes";
"io";
"os";
"net";
@ -59,7 +58,7 @@ func (tls *Conn) Read(p []byte) (int, os.Error) {
}
}
n := bytes.Copy(p, tls.readBuf);
n := copy(p, tls.readBuf);
tls.readBuf = tls.readBuf[n:len(tls.readBuf)];
return n, nil;
}

5
src/pkg/encoding/ascii85/ascii85.go
View File

@ -7,7 +7,6 @@
package ascii85
import (
"bytes";
"io";
"os";
"strconv";
@ -268,7 +267,7 @@ func (d *decoder) Read(p []byte) (n int, err os.Error) {
for {
// Copy leftover output from last decode.
if len(d.out) > 0 {
n = bytes.Copy(p, d.out);
n = copy(p, d.out);
d.out = d.out[n:len(d.out)];
return;
}
@ -279,7 +278,7 @@ func (d *decoder) Read(p []byte) (n int, err os.Error) {
ndst, nsrc, d.err = Decode(&d.outbuf, d.buf[0:d.nbuf], d.readErr != nil);
if ndst > 0 {
d.out = d.outbuf[0:ndst];
d.nbuf = bytes.Copy(&d.buf, d.buf[nsrc:d.nbuf]);
d.nbuf = copy(&d.buf, d.buf[nsrc:d.nbuf]);
continue; // copy out and return
}
}

5
src/pkg/encoding/base64/base64.go
View File

@ -6,7 +6,6 @@
package base64
import (
"bytes";
"io";
"os";
"strconv";
@ -279,7 +278,7 @@ func (d *decoder) Read(p []byte) (n int, err os.Error) {
// Use leftover decoded output from last read.
if len(d.out) > 0 {
n = bytes.Copy(p, d.out);
n = copy(p, d.out);
d.out = d.out[n:len(d.out)];
return n, nil;
}
@ -304,7 +303,7 @@ func (d *decoder) Read(p []byte) (n int, err os.Error) {
if nw > len(p) {
nw, d.end, d.err = d.enc.decode(&d.outbuf, d.buf[0:nr]);
d.out = d.outbuf[0:nw];
n = bytes.Copy(p, d.out);
n = copy(p, d.out);
d.out = d.out[n:len(d.out)];
} else {
n, d.end, d.err = d.enc.decode(p, d.buf[0:nr])

4
src/pkg/encoding/git85/git.go
View File

@ -241,7 +241,7 @@ func (d *decoder) Read(p []byte) (n int, err os.Error) {
for {
// Copy leftover output from last decode.
if len(d.out) > 0 {
n = bytes.Copy(p, d.out);
n = copy(p, d.out);
d.out = d.out[n:len(d.out)];
return;
}
@ -270,7 +270,7 @@ func (d *decoder) Read(p []byte) (n int, err os.Error) {
d.err = CorruptInputError(int64(e) + d.off)
}
d.out = d.outbuf[0:nn];
d.nbuf = bytes.Copy(&d.buf, d.buf[nl+1:d.nbuf]);
d.nbuf = copy(&d.buf, d.buf[nl+1:d.nbuf]);
d.off += int64(nl + 1);
}
panic("unreacahable");

22
src/pkg/regexp/regexp.go
View File

@ -277,9 +277,8 @@ func newParser(re *Regexp) *parser {
}
func special(c int) bool {
s := `\.+*?()|[]^$`;
for i := 0; i < len(s); i++ {
if c == int(s[i]) {
for _, r := range `\.+*?()|[]^$` {
if c == r {
return true
}
}
@ -287,9 +286,8 @@ func special(c int) bool {
}
func specialcclass(c int) bool {
s := `\-[]`;
for i := 0; i < len(s); i++ {
if c == int(s[i]) {
for _, r := range `\-[]` {
if c == r {
return true
}
}
@ -675,9 +673,7 @@ func (re *Regexp) addState(s []state, inst instr, match []int, pos, end int) []s
}
if l == cap(s) {
s1 := make([]state, 2*l)[0:l];
for i := 0; i < l; i++ {
s1[i] = s[i]
}
copy(s1, s);
s = s1;
}
s = s[0 : l+1];
@ -685,15 +681,11 @@ func (re *Regexp) addState(s []state, inst instr, match []int, pos, end int) []s
s[l].match = match;
if inst.kind() == _ALT {
s1 := make([]int, 2*(re.nbra+1));
for i := 0; i < len(s1); i++ {
s1[i] = match[i]
}
copy(s1, match);
s = re.addState(s, inst.(*_Alt).left, s1, pos, end);
// give other branch a copy of this match vector
s1 = make([]int, 2*(re.nbra+1));
for i := 0; i < len(s1); i++ {
s1[i] = match[i]
}
copy(s1, match);
s = re.addState(s, inst.next(), s1, pos, end);
}
return s;

10
src/pkg/strconv/decimal.go
View File

@ -11,8 +11,6 @@
package strconv
import "bytes"
type decimal struct {
// TODO(rsc): Can make d[] a bit smaller and add
// truncated bool;
@ -43,18 +41,18 @@ func (a *decimal) String() string {
buf[w] = '.';
w++;
w += digitZero(buf[w : w+-a.dp]);
w += bytes.Copy(buf[w:w+a.nd], a.d[0:a.nd]);
w += copy(buf[w:w+a.nd], a.d[0:a.nd]);
case a.dp < a.nd:
// decimal point in middle of digits
w += bytes.Copy(buf[w:w+a.dp], a.d[0:a.dp]);
w += copy(buf[w:w+a.dp], a.d[0:a.dp]);
buf[w] = '.';
w++;
w += bytes.Copy(buf[w:w+a.nd-a.dp], a.d[a.dp:a.nd]);
w += copy(buf[w:w+a.nd-a.dp], a.d[a.dp:a.nd]);
default:
// zeros fill space between digits and decimal point
w += bytes.Copy(buf[w:w+a.nd], a.d[0:a.nd]);
w += copy(buf[w:w+a.nd], a.d[0:a.nd]);
w += digitZero(buf[w : w+a.dp-a.nd]);
}
return string(buf[0:w]);

3
src/pkg/testing/iotest/reader.go
View File

@ -9,7 +9,6 @@ package iotest
import (
"io";
"os";
"bytes";
)
// OneByteReader returns a Reader that implements
@ -63,7 +62,7 @@ func (r *dataErrReader) Read(p []byte) (n int, err os.Error) {
if n > 0 {
break
}
n = bytes.Copy(p, r.unread);
n = copy(p, r.unread);
r.unread = r.unread[n:len(r.unread)];
}
return;

12
src/pkg/xml/xml.go
View File

@ -65,19 +65,19 @@ type EndElement struct {
// the characters they represent.
type CharData []byte
func copy(b []byte) []byte {
func makeCopy(b []byte) []byte {
b1 := make([]byte, len(b));
bytes.Copy(b1, b);
copy(b1, b);
return b1;
}
func (c CharData) Copy() CharData { return CharData(copy(c)) }
func (c CharData) Copy() CharData { return CharData(makeCopy(c)) }
// A Comment represents an XML comment of the form <!--comment-->.
// The bytes do not include the <!-- and --> comment markers.
type Comment []byte
func (c Comment) Copy() Comment { return Comment(copy(c)) }
func (c Comment) Copy() Comment { return Comment(makeCopy(c)) }
// A ProcInst represents an XML processing instruction of the form <?target inst?>
type ProcInst struct {
@ -86,7 +86,7 @@ type ProcInst struct {
}
func (p ProcInst) Copy() ProcInst {
p.Inst = copy(p.Inst);
p.Inst = makeCopy(p.Inst);
return p;
}
@ -94,7 +94,7 @@ func (p ProcInst) Copy() ProcInst {
// The bytes do not include the <! and > markers.
type Directive []byte
func (d Directive) Copy() Directive { return Directive(copy(d)) }
func (d Directive) Copy() Directive { return Directive(makeCopy(d)) }
type readByter interface {
ReadByte() (b byte, err os.Error);

89
test/bench/fasta.go
View File

@ -39,7 +39,6 @@ package main
import (
"bufio";
"bytes";
"flag";
"os";
"strings";
@ -55,7 +54,7 @@ func min(a, b int) int {
if a < b {
return a
}
return b
return b;
}
type AminoAcid struct {
@ -63,23 +62,23 @@ type AminoAcid struct {
c byte;
}
var lastrandom uint32 = 42
var lastrandom uint32 = 42
// Random number between 0.0 and 1.0
func myrandom() float {
const (
IM = 139968;
IA = 3877;
IC = 29573;
IM = 139968;
IA = 3877;
IC = 29573;
)
lastrandom = (lastrandom * IA + IC) % IM;
lastrandom = (lastrandom*IA + IC) % IM;
// Integer to float conversions are faster if the integer is signed.
return float(int32(lastrandom)) / IM;
}
func AccumulateProbabilities(genelist []AminoAcid) {
for i := 1; i < len(genelist); i++ {
genelist[i].p += genelist[i-1].p;
genelist[i].p += genelist[i-1].p
}
}
@ -90,16 +89,16 @@ func AccumulateProbabilities(genelist []AminoAcid) {
// It assumes that WIDTH <= len(s) + 1.
func RepeatFasta(s []byte, count int) {
pos := 0;
s2 := make([]byte, len(s) + WIDTH);
bytes.Copy(s2, s);
bytes.Copy(s2[len(s):len(s2)], s);
s2 := make([]byte, len(s)+WIDTH);
copy(s2, s);
copy(s2[len(s):len(s2)], s);
for count > 0 {
line := min(WIDTH, count);
out.Write(s2[pos:pos+line]);
out.Write(s2[pos : pos+line]);
out.WriteByte('\n');
pos += line;
if pos >= len(s) {
pos -= len(s);
pos -= len(s)
}
count -= line;
}
@ -114,7 +113,7 @@ func RepeatFasta(s []byte, count int) {
// This sequence is repeated count times.
// Between each WIDTH consecutive characters, the function prints a newline.
func RandomFasta(genelist []AminoAcid, count int) {
buf := make([]byte, WIDTH + 1);
buf := make([]byte, WIDTH+1);
for count > 0 {
line := min(WIDTH, count);
for pos := 0; pos < line; pos++ {
@ -125,7 +124,7 @@ func RandomFasta(genelist []AminoAcid, count int) {
buf[pos] = genelist[i].c;
}
buf[line] = '\n';
out.Write(buf[0:line + 1]);
out.Write(buf[0 : line+1]);
count -= line;
}
}
@ -136,29 +135,29 @@ func main() {
flag.Parse();
iub := []AminoAcid {
AminoAcid{ 0.27, 'a' },
AminoAcid{ 0.12, 'c' },
AminoAcid{ 0.12, 'g' },
AminoAcid{ 0.27, 't' },
AminoAcid{ 0.02, 'B' },
AminoAcid{ 0.02, 'D' },
AminoAcid{ 0.02, 'H' },
AminoAcid{ 0.02, 'K' },
AminoAcid{ 0.02, 'M' },
AminoAcid{ 0.02, 'N' },
AminoAcid{ 0.02, 'R' },
AminoAcid{ 0.02, 'S' },
AminoAcid{ 0.02, 'V' },
AminoAcid{ 0.02, 'W' },
AminoAcid{ 0.02, 'Y' }
iub := []AminoAcid{
AminoAcid{0.27, 'a'},
AminoAcid{0.12, 'c'},
AminoAcid{0.12, 'g'},
AminoAcid{0.27, 't'},
AminoAcid{0.02, 'B'},
AminoAcid{0.02, 'D'},
AminoAcid{0.02, 'H'},
AminoAcid{0.02, 'K'},
AminoAcid{0.02, 'M'},
AminoAcid{0.02, 'N'},
AminoAcid{0.02, 'R'},
AminoAcid{0.02, 'S'},
AminoAcid{0.02, 'V'},
AminoAcid{0.02, 'W'},
AminoAcid{0.02, 'Y'},
};
homosapiens := []AminoAcid {
AminoAcid{ 0.3029549426680, 'a' },
AminoAcid{ 0.1979883004921, 'c' },
AminoAcid{ 0.1975473066391, 'g' },
AminoAcid{ 0.3015094502008, 't' }
homosapiens := []AminoAcid{
AminoAcid{0.3029549426680, 'a'},
AminoAcid{0.1979883004921, 'c'},
AminoAcid{0.1975473066391, 'g'},
AminoAcid{0.3015094502008, 't'},
};
AccumulateProbabilities(iub);
@ -166,17 +165,17 @@ func main() {
alu := strings.Bytes(
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA");
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA");
out.WriteString(">ONE Homo sapiens alu\n");
RepeatFasta(alu, 2 * *n);
RepeatFasta(alu, 2**n);
out.WriteString(">TWO IUB ambiguity codes\n");
RandomFasta(iub, 3 * *n);
RandomFasta(iub, 3**n);
out.WriteString(">THREE Homo sapiens frequency\n");
RandomFasta(homosapiens, 5 * *n);
RandomFasta(homosapiens, 5**n);
}

51
test/bench/reverse-complement.go
View File

@ -37,39 +37,38 @@ package main
import (
"bufio";
"bytes";
"os";
)
const lineSize = 60
const lineSize = 60
var complement = [256]uint8 {
'A': 'T', 'a': 'T',
'C': 'G', 'c': 'G',
'G': 'C', 'g': 'C',
'T': 'A', 't': 'A',
'U': 'A', 'u': 'A',
'M': 'K', 'm': 'K',
'R': 'Y', 'r': 'Y',
'W': 'W', 'w': 'W',
'S': 'S', 's': 'S',
'Y': 'R', 'y': 'R',
'K': 'M', 'k': 'M',
'V': 'B', 'v': 'B',
'H': 'D', 'h': 'D',
'D': 'H', 'd': 'H',
'B': 'V', 'b': 'V',
'N': 'N', 'n': 'N',
var complement = [256]uint8{
'A': 'T', 'a': 'T',
'C': 'G', 'c': 'G',
'G': 'C', 'g': 'C',
'T': 'A', 't': 'A',
'U': 'A', 'u': 'A',
'M': 'K', 'm': 'K',
'R': 'Y', 'r': 'Y',
'W': 'W', 'w': 'W',
'S': 'S', 's': 'S',
'Y': 'R', 'y': 'R',
'K': 'M', 'k': 'M',
'V': 'B', 'v': 'B',
'H': 'D', 'h': 'D',
'D': 'H', 'd': 'H',
'B': 'V', 'b': 'V',
'N': 'N', 'n': 'N',
}
var in *bufio.Reader
func reverseComplement(in []byte) []byte {
outLen := len(in) + (len(in) + lineSize -1)/lineSize;
outLen := len(in) + (len(in)+lineSize-1)/lineSize;
out := make([]byte, outLen);
j := 0;
k := 0;
for i := len(in)-1; i >= 0; i-- {
for i := len(in) - 1; i >= 0; i-- {
if k == lineSize {
out[j] = '\n';
j++;
@ -106,15 +105,15 @@ func main() {
top = 0;
}
os.Stdout.Write(line);
continue
continue;
}
line = line[0:len(line)-1]; // drop newline
line = line[0 : len(line)-1]; // drop newline
if top+len(line) > len(buf) {
nbuf := make([]byte, 2*len(buf) + 1024*(100+len(line)));
bytes.Copy(nbuf, buf[0:top]);
nbuf := make([]byte, 2*len(buf)+1024*(100+len(line)));
copy(nbuf, buf[0:top]);
buf = nbuf;
}
bytes.Copy(buf[top:len(buf)], line);
copy(buf[top:len(buf)], line);
top += len(line);
}
output(buf[0:top]);