strings: delete Runes, Bytes

gofmt -w -r 'strings.Bytes(a) -> []byte(a)' src/cmd src/pkg test/bench
gofmt -w -r 'strings.Runes(a) -> []int(a)' src/cmd src/pkg test/bench
delete unused imports

R=r
CC=golang-dev
https://golang.org/cl/224062

src/cmd/cgo/gcc.go

@@ -724,7 +724,7 @@ func (c *typeConv) Opaque(n int64) ast.Expr {
 func (c *typeConv) intExpr(n int64) ast.Expr {
 	return &ast.BasicLit{
 		Kind: token.INT,
-		Value: strings.Bytes(strconv.Itoa64(n)),
+		Value: []byte(strconv.Itoa64(n)),
 	}
 }
 
@@ -755,7 +755,7 @@ func (c *typeConv) Struct(dt *dwarf.StructType) (expr *ast.StructType, csyntax s
 		used[f.Name] = true
 	}
 	for cid, goid := range ident {
-		if token.Lookup(strings.Bytes(goid)).IsKeyword() {
+		if token.Lookup([]byte(goid)).IsKeyword() {
 			// Avoid keyword
 			goid = "_" + goid
 

src/cmd/ebnflint/ebnflint.go

@@ -13,7 +13,6 @@ import (
 	"io/ioutil"
 	"os"
 	"path"
-	"strings"
 )
 
 
@@ -29,8 +28,8 @@ func usage() {
 
 // Markers around EBNF sections in .html files
 var (
-	open  = strings.Bytes(`<pre class="ebnf">`)
+	open  = []byte(`<pre class="ebnf">`)
-	close = strings.Bytes(`</pre>`)
+	close = []byte(`</pre>`)
 )
 
 

src/cmd/godoc/godoc.go

@@ -152,7 +152,7 @@ func pkgName(filename string) string {
 
 func htmlEscape(s string) string {
 	var buf bytes.Buffer
-	template.HTMLEscape(&buf, strings.Bytes(s))
+	template.HTMLEscape(&buf, []byte(s))
 	return buf.String()
 }
 
@@ -476,7 +476,7 @@ func (s *Styler) BasicLit(x *ast.BasicLit) (text []byte, tag printer.HTMLTag) {
 
 
 func (s *Styler) Ident(id *ast.Ident) (text []byte, tag printer.HTMLTag) {
-	text = strings.Bytes(id.Name())
+	text = []byte(id.Name())
 	if s.highlight == id.Name() {
 		tag = printer.HTMLTag{"<span class=highlight>", "</span>"}
 	}
@@ -485,7 +485,7 @@ func (s *Styler) Ident(id *ast.Ident) (text []byte, tag printer.HTMLTag) {
 
 
 func (s *Styler) Token(tok token.Token) (text []byte, tag printer.HTMLTag) {
-	text = strings.Bytes(tok.String())
+	text = []byte(tok.String())
 	return
 }
 
@@ -493,7 +493,7 @@ func (s *Styler) Token(tok token.Token) (text []byte, tag printer.HTMLTag) {
 // ----------------------------------------------------------------------------
 // Tab conversion
 
-var spaces = strings.Bytes("                ") // 16 spaces seems like a good number
+var spaces = []byte("                ") // 16 spaces seems like a good number
 
 const (
 	indenting = iota
@@ -595,7 +595,7 @@ func writeAny(w io.Writer, x interface{}, html bool) {
 	case []byte:
 		writeText(w, v, html)
 	case string:
-		writeText(w, strings.Bytes(v), html)
+		writeText(w, []byte(v), html)
 	case ast.Decl, ast.Expr, ast.Stmt, *ast.File:
 		writeNode(w, x, html, &defaultStyler)
 	default:
@@ -674,13 +674,13 @@ func urlFmt(w io.Writer, x interface{}, format string) {
 		if strings.HasPrefix(relpath, "src/pkg/") {
 			relpath = relpath[len("src/pkg/"):]
 		}
-		template.HTMLEscape(w, strings.Bytes(pkgHandler.pattern+relpath))
+		template.HTMLEscape(w, []byte(pkgHandler.pattern+relpath))
 	case "url-src":
-		template.HTMLEscape(w, strings.Bytes("/"+relpath))
+		template.HTMLEscape(w, []byte("/"+relpath))
 	case "url-pos":
 		// line id's in html-printed source are of the
 		// form "L%d" where %d stands for the line number
-		template.HTMLEscape(w, strings.Bytes("/"+relpath))
+		template.HTMLEscape(w, []byte("/"+relpath))
 		fmt.Fprintf(w, "#L%d", line)
 	}
 }
@@ -742,7 +742,7 @@ func paddingFmt(w io.Writer, x interface{}, format string) {
 // Template formatter for "time" format.
 func timeFmt(w io.Writer, x interface{}, format string) {
 	// note: os.Dir.Mtime_ns is in uint64 in ns!
-	template.HTMLEscape(w, strings.Bytes(time.SecondsToLocalTime(int64(x.(uint64)/1e9)).String()))
+	template.HTMLEscape(w, []byte(time.SecondsToLocalTime(int64(x.(uint64)/1e9)).String()))
 }
 
 
@@ -757,7 +757,7 @@ func dirslashFmt(w io.Writer, x interface{}, format string) {
 // Template formatter for "localname" format.
 func localnameFmt(w io.Writer, x interface{}, format string) {
 	_, localname := pathutil.Split(x.(string))
-	template.HTMLEscape(w, strings.Bytes(localname))
+	template.HTMLEscape(w, []byte(localname))
 }
 
 
@@ -852,8 +852,8 @@ func serveText(c *http.Conn, text []byte) {
 // Files
 
 var (
-	tagBegin = strings.Bytes("<!--")
+	tagBegin = []byte("<!--")
-	tagEnd   = strings.Bytes("-->")
+	tagEnd   = []byte("-->")
 )
 
 // commentText returns the text of the first HTML comment in src.
@@ -878,7 +878,7 @@ func serveHTMLDoc(c *http.Conn, r *http.Request, abspath, relpath string) {
 
 	// if it begins with "<!DOCTYPE " assume it is standalone
 	// html that doesn't need the template wrapping.
-	if bytes.HasPrefix(src, strings.Bytes("<!DOCTYPE ")) {
+	if bytes.HasPrefix(src, []byte("<!DOCTYPE ")) {
 		c.Write(src)
 		return
 	}

src/cmd/godoc/index.go

@@ -696,7 +696,7 @@ func (x *Index) LookupWord(w string) (match *LookupResult, alt *AltWords) {
 
 func isIdentifier(s string) bool {
 	var S scanner.Scanner
-	S.Init("", strings.Bytes(s), nil, 0)
+	S.Init("", []byte(s), nil, 0)
 	if _, tok, _ := S.Scan(); tok == token.IDENT {
 		_, tok, _ := S.Scan()
 		return tok == token.EOF

src/cmd/godoc/snippet.go

@@ -14,7 +14,6 @@ import (
 	"go/ast"
 	"go/printer"
 	"fmt"
-	"strings"
 )
 
 
@@ -36,7 +35,7 @@ func (s *snippetStyler) LineTag(line int) (text []uint8, tag printer.HTMLTag) {
 
 
 func (s *snippetStyler) Ident(id *ast.Ident) (text []byte, tag printer.HTMLTag) {
-	text = strings.Bytes(id.Name())
+	text = []byte(id.Name())
 	if s.highlight == id {
 		tag = printer.HTMLTag{"<span class=highlight>", "</span>"}
 	}

src/cmd/godoc/spec.go

@@ -16,7 +16,6 @@ import (
 	"go/scanner"
 	"go/token"
 	"io"
-	"strings"
 )
 
 
@@ -166,8 +165,8 @@ func (p *ebnfParser) parse(out io.Writer, src []byte) {
 
 // Markers around EBNF sections
 var (
-	openTag  = strings.Bytes(`<pre class="ebnf">`)
+	openTag  = []byte(`<pre class="ebnf">`)
-	closeTag = strings.Bytes(`</pre>`)
+	closeTag = []byte(`</pre>`)
 )
 
 

src/pkg/archive/tar/reader_test.go

@@ -11,7 +11,6 @@ import (
 	"io"
 	"os"
 	"reflect"
-	"strings"
 	"testing"
 )
 
@@ -161,7 +160,7 @@ func TestPartialRead(t *testing.T) {
 	if _, err := io.ReadFull(tr, buf); err != nil {
 		t.Fatalf("Unexpected error: %v", err)
 	}
-	if expected := strings.Bytes("Kilt"); !bytes.Equal(buf, expected) {
+	if expected := []byte("Kilt"); !bytes.Equal(buf, expected) {
 		t.Errorf("Contents = %v, want %v", buf, expected)
 	}
 
@@ -174,7 +173,7 @@ func TestPartialRead(t *testing.T) {
 	if _, err := io.ReadFull(tr, buf); err != nil {
 		t.Fatalf("Unexpected error: %v", err)
 	}
-	if expected := strings.Bytes("Google"); !bytes.Equal(buf, expected) {
+	if expected := []byte("Google"); !bytes.Equal(buf, expected) {
 		t.Errorf("Contents = %v, want %v", buf, expected)
 	}
 }

src/pkg/archive/tar/writer.go

@@ -11,7 +11,6 @@ import (
 	"io"
 	"os"
 	"strconv"
-	"strings"
 )
 
 var (
@@ -72,7 +71,7 @@ func (tw *Writer) cString(b []byte, s string) {
 		}
 		return
 	}
-	for i, ch := range strings.Bytes(s) {
+	for i, ch := range []byte(s) {
 		b[i] = ch
 	}
 	if len(s) < len(b) {
@@ -128,7 +127,7 @@ func (tw *Writer) WriteHeader(hdr *Header) os.Error {
 	s := slicer(header)
 
 	// TODO(dsymonds): handle names longer than 100 chars
-	copy(s.next(100), strings.Bytes(hdr.Name))
+	copy(s.next(100), []byte(hdr.Name))
 
 	tw.octal(s.next(8), hdr.Mode)          // 100:108
 	tw.numeric(s.next(8), hdr.Uid)         // 108:116
@@ -138,7 +137,7 @@ func (tw *Writer) WriteHeader(hdr *Header) os.Error {
 	s.next(8)                              // chksum (148:156)
 	s.next(1)[0] = hdr.Typeflag            // 156:157
 	s.next(100)                            // linkname (157:257)
-	copy(s.next(8), strings.Bytes("ustar\x0000")) // 257:265
+	copy(s.next(8), []byte("ustar\x0000")) // 257:265
 	tw.cString(s.next(32), hdr.Uname)      // 265:297
 	tw.cString(s.next(32), hdr.Gname)      // 297:329
 	tw.numeric(s.next(8), hdr.Devmajor)    // 329:337
@@ -146,7 +145,7 @@ func (tw *Writer) WriteHeader(hdr *Header) os.Error {
 
 	// Use the GNU magic instead of POSIX magic if we used any GNU extensions.
 	if tw.usedBinary {
-		copy(header[257:265], strings.Bytes("ustar  \x00"))
+		copy(header[257:265], []byte("ustar  \x00"))
 	}
 
 	// The chksum field is terminated by a NUL and a space.

src/pkg/asn1/asn1_test.go

@@ -7,7 +7,6 @@ package asn1
 import (
 	"bytes"
 	"reflect"
-	"strings"
 	"testing"
 	"time"
 )
@@ -165,7 +164,7 @@ var timeTestData = []timeTest{
 
 func TestTime(t *testing.T) {
 	for i, test := range timeTestData {
-		ret, err := parseUTCTime(strings.Bytes(test.in))
+		ret, err := parseUTCTime([]byte(test.in))
 		if (err == nil) != test.ok {
 			t.Errorf("#%d: Incorrect error result (did fail? %v, expected: %v)", i, err == nil, test.ok)
 		}

src/pkg/asn1/marshal.go

@@ -10,7 +10,6 @@ import (
 	"io"
 	"os"
 	"reflect"
-	"strings"
 	"time"
 )
 
@@ -209,7 +208,7 @@ func marshalObjectIdentifier(out *forkableWriter, oid []int) (err os.Error) {
 }
 
 func marshalPrintableString(out *forkableWriter, s string) (err os.Error) {
-	b := strings.Bytes(s)
+	b := []byte(s)
 	for _, c := range b {
 		if !isPrintable(c) {
 			return StructuralError{"PrintableString contains invalid character"}
@@ -221,7 +220,7 @@ func marshalPrintableString(out *forkableWriter, s string) (err os.Error) {
 }
 
 func marshalIA5String(out *forkableWriter, s string) (err os.Error) {
-	b := strings.Bytes(s)
+	b := []byte(s)
 	for _, c := range b {
 		if c > 127 {
 			return StructuralError{"IA5String contains invalid character"}

src/pkg/bufio/bufio_test.go

@@ -296,7 +296,7 @@ var errorWriterTests = []errorWriterTest{
 func TestWriteErrors(t *testing.T) {
 	for _, w := range errorWriterTests {
 		buf := NewWriter(w)
-		_, e := buf.Write(strings.Bytes("hello world"))
+		_, e := buf.Write([]byte("hello world"))
 		if e != nil {
 			t.Errorf("Write hello to %v: %v", w, e)
 			continue

src/pkg/bytes/bytes_test.go

@@ -6,7 +6,6 @@ package bytes_test
 
 import (
 	. "bytes"
-	"strings"
 	"testing"
 	"unicode"
 )
@@ -60,8 +59,8 @@ var comparetests = []BinOpTest{
 
 func TestCompare(t *testing.T) {
 	for _, tt := range comparetests {
-		a := strings.Bytes(tt.a)
+		a := []byte(tt.a)
-		b := strings.Bytes(tt.b)
+		b := []byte(tt.b)
 		cmp := Compare(a, b)
 		eql := Equal(a, b)
 		if cmp != tt.i {
@@ -94,8 +93,8 @@ var indextests = []BinOpTest{
 
 func TestIndex(t *testing.T) {
 	for _, tt := range indextests {
-		a := strings.Bytes(tt.a)
+		a := []byte(tt.a)
-		b := strings.Bytes(tt.b)
+		b := []byte(tt.b)
 		pos := Index(a, b)
 		if pos != tt.i {
 			t.Errorf(`Index(%q, %q) = %v`, tt.a, tt.b, pos)
@@ -108,7 +107,7 @@ func TestIndexByte(t *testing.T) {
 		if len(tt.b) != 1 {
 			continue
 		}
-		a := strings.Bytes(tt.a)
+		a := []byte(tt.a)
 		b := tt.b[0]
 		pos := IndexByte(a, b)
 		if pos != tt.i {
@@ -171,7 +170,7 @@ var explodetests = []ExplodeTest{
 
 func TestExplode(t *testing.T) {
 	for _, tt := range explodetests {
-		a := Split(strings.Bytes(tt.s), nil, tt.n)
+		a := Split([]byte(tt.s), nil, tt.n)
 		result := arrayOfString(a)
 		if !eq(result, tt.a) {
 			t.Errorf(`Explode("%s", %d) = %v; want %v`, tt.s, tt.n, result, tt.a)
@@ -210,13 +209,13 @@ var splittests = []SplitTest{
 
 func TestSplit(t *testing.T) {
 	for _, tt := range splittests {
-		a := Split(strings.Bytes(tt.s), strings.Bytes(tt.sep), tt.n)
+		a := Split([]byte(tt.s), []byte(tt.sep), tt.n)
 		result := arrayOfString(a)
 		if !eq(result, tt.a) {
 			t.Errorf(`Split(%q, %q, %d) = %v; want %v`, tt.s, tt.sep, tt.n, result, tt.a)
 			continue
 		}
-		s := Join(a, strings.Bytes(tt.sep))
+		s := Join(a, []byte(tt.sep))
 		if string(s) != tt.s {
 			t.Errorf(`Join(Split(%q, %q, %d), %q) = %q`, tt.s, tt.sep, tt.n, tt.sep, s)
 		}
@@ -241,7 +240,7 @@ var splitaftertests = []SplitTest{
 
 func TestSplitAfter(t *testing.T) {
 	for _, tt := range splitaftertests {
-		a := SplitAfter(strings.Bytes(tt.s), strings.Bytes(tt.sep), tt.n)
+		a := SplitAfter([]byte(tt.s), []byte(tt.sep), tt.n)
 		result := arrayOfString(a)
 		if !eq(result, tt.a) {
 			t.Errorf(`Split(%q, %q, %d) = %v; want %v`, tt.s, tt.sep, tt.n, result, tt.a)
@@ -275,7 +274,7 @@ var fieldstests = []FieldsTest{
 
 func TestFields(t *testing.T) {
 	for _, tt := range fieldstests {
-		a := Fields(strings.Bytes(tt.s))
+		a := Fields([]byte(tt.s))
 		result := arrayOfString(a)
 		if !eq(result, tt.a) {
 			t.Errorf("Fields(%q) = %v; want %v", tt.s, a, tt.a)
@@ -434,7 +433,7 @@ func TestAdd(t *testing.T) {
 		for i := 0; i < len(test.s); i++ {
 			b[i] = test.s[i]
 		}
-		b = Add(b, strings.Bytes(test.t))
+		b = Add(b, []byte(test.t))
 		if string(b) != test.s+test.t {
 			t.Errorf("Add(%q,%q) = %q", test.s, test.t, string(b))
 		}
@@ -474,8 +473,8 @@ var RepeatTests = []RepeatTest{
 
 func TestRepeat(t *testing.T) {
 	for _, tt := range RepeatTests {
-		tin := strings.Bytes(tt.in)
+		tin := []byte(tt.in)
-		tout := strings.Bytes(tt.out)
+		tout := []byte(tt.out)
 		a := Repeat(tin, tt.count)
 		if !Equal(a, tout) {
 			t.Errorf("Repeat(%q, %d) = %q; want %q", tin, tt.count, a, tout)
@@ -514,7 +513,7 @@ var RunesTests = []RunesTest{
 
 func TestRunes(t *testing.T) {
 	for _, tt := range RunesTests {
-		tin := strings.Bytes(tt.in)
+		tin := []byte(tt.in)
 		a := Runes(tin)
 		if !runesEqual(a, tt.out) {
 			t.Errorf("Runes(%q) = %v; want %v", tin, a, tt.out)

src/pkg/compress/gzip/gzip_test.go

@@ -7,7 +7,6 @@ package gzip
 import (
 	"io"
 	"io/ioutil"
-	"strings"
 	"testing"
 )
 
@@ -53,10 +52,10 @@ func TestWriter(t *testing.T) {
 	pipe(t,
 		func(deflater *Deflater) {
 			deflater.Comment = "comment"
-			deflater.Extra = strings.Bytes("extra")
+			deflater.Extra = []byte("extra")
 			deflater.Mtime = 1e8
 			deflater.Name = "name"
-			_, err := deflater.Write(strings.Bytes("payload"))
+			_, err := deflater.Write([]byte("payload"))
 			if err != nil {
 				t.Fatalf("%v", err)
 			}

src/pkg/crypto/hmac/hmac_test.go

@@ -7,7 +7,6 @@ package hmac
 import (
 	"hash"
 	"fmt"
-	"strings"
 	"testing"
 )
 
@@ -33,7 +32,7 @@ var hmacTests = []hmacTest{
 			0x30, 0x31, 0x32, 0x33, 0x34, 0x35, 0x36, 0x37,
 			0x38, 0x39, 0x3a, 0x3b, 0x3c, 0x3d, 0x3e, 0x3f,
 		},
-		strings.Bytes("Sample #1"),
+		[]byte("Sample #1"),
 		"4f4ca3d5d68ba7cc0a1208c9c61e9c5da0403c0a",
 	},
 	hmacTest{
@@ -43,7 +42,7 @@ var hmacTests = []hmacTest{
 			0x38, 0x39, 0x3a, 0x3b, 0x3c, 0x3d, 0x3e, 0x3f,
 			0x40, 0x41, 0x42, 0x43,
 		},
-		strings.Bytes("Sample #2"),
+		[]byte("Sample #2"),
 		"0922d3405faa3d194f82a45830737d5cc6c75d24",
 	},
 	hmacTest{
@@ -63,15 +62,15 @@ var hmacTests = []hmacTest{
 			0xa8, 0xa9, 0xaa, 0xab, 0xac, 0xad, 0xae, 0xaf,
 			0xb0, 0xb1, 0xb2, 0xb3,
 		},
-		strings.Bytes("Sample #3"),
+		[]byte("Sample #3"),
 		"bcf41eab8bb2d802f3d05caf7cb092ecf8d1a3aa",
 	},
 
 	// Test from Plan 9.
 	hmacTest{
 		NewMD5,
-		strings.Bytes("Jefe"),
+		[]byte("Jefe"),
-		strings.Bytes("what do ya want for nothing?"),
+		[]byte("what do ya want for nothing?"),
 		"750c783e6ab0b503eaa86e310a5db738",
 	},
 }

src/pkg/crypto/rsa/pkcs1v15_test.go

@@ -12,14 +12,13 @@ import (
 	"encoding/hex"
 	"os"
 	"io"
-	"strings"
 	"testing"
 	"testing/quick"
 )
 
 func decodeBase64(in string) []byte {
 	out := make([]byte, base64.StdEncoding.DecodedLen(len(in)))
-	n, err := base64.StdEncoding.Decode(out, strings.Bytes(in))
+	n, err := base64.StdEncoding.Decode(out, []byte(in))
 	if err != nil {
 		return nil
 	}
@@ -56,7 +55,7 @@ func TestDecryptPKCS1v15(t *testing.T) {
 		if err != nil {
 			t.Errorf("#%d error decrypting", i)
 		}
-		want := strings.Bytes(test.out)
+		want := []byte(test.out)
 		if bytes.Compare(out, want) != 0 {
 			t.Errorf("#%d got:%#v want:%#v", i, out, want)
 		}
@@ -125,12 +124,12 @@ var decryptPKCS1v15SessionKeyTests = []DecryptPKCS1v15Test{
 
 func TestEncryptPKCS1v15SessionKey(t *testing.T) {
 	for i, test := range decryptPKCS1v15SessionKeyTests {
-		key := strings.Bytes("FAIL")
+		key := []byte("FAIL")
 		err := DecryptPKCS1v15SessionKey(nil, rsaPrivateKey, decodeBase64(test.in), key)
 		if err != nil {
 			t.Errorf("#%d error decrypting", i)
 		}
-		want := strings.Bytes(test.out)
+		want := []byte(test.out)
 		if bytes.Compare(key, want) != 0 {
 			t.Errorf("#%d got:%#v want:%#v", i, key, want)
 		}
@@ -169,7 +168,7 @@ var signPKCS1v15Tests = []signPKCS1v15Test{
 func TestSignPKCS1v15(t *testing.T) {
 	for i, test := range signPKCS1v15Tests {
 		h := sha1.New()
-		h.Write(strings.Bytes(test.in))
+		h.Write([]byte(test.in))
 		digest := h.Sum()
 
 		s, err := SignPKCS1v15(nil, rsaPrivateKey, HashSHA1, digest)
@@ -187,7 +186,7 @@ func TestSignPKCS1v15(t *testing.T) {
 func TestVerifyPKCS1v15(t *testing.T) {
 	for i, test := range signPKCS1v15Tests {
 		h := sha1.New()
-		h.Write(strings.Bytes(test.in))
+		h.Write([]byte(test.in))
 		digest := h.Sum()
 
 		sig, _ := hex.DecodeString(test.out)

src/pkg/crypto/tls/handshake_messages.go

@@ -4,8 +4,6 @@
 
 package tls
 
-import "strings"
-
 type clientHelloMsg struct {
 	raw                []byte
 	major, minor       uint8
@@ -100,7 +98,7 @@ func (m *clientHelloMsg) marshal() []byte {
 		z[1] = 1
 		z[3] = byte(len(m.serverName) >> 8)
 		z[4] = byte(len(m.serverName))
-		copy(z[5:], strings.Bytes(m.serverName))
+		copy(z[5:], []byte(m.serverName))
 		z = z[l:]
 	}
 
@@ -280,7 +278,7 @@ func (m *serverHelloMsg) marshal() []byte {
 				l = 255
 			}
 			z[0] = byte(l)
-			copy(z[1:], strings.Bytes(v[0:l]))
+			copy(z[1:], []byte(v[0:l]))
 			z = z[1+l:]
 		}
 	}
@@ -548,7 +546,7 @@ func (m *nextProtoMsg) marshal() []byte {
 
 	y := x[4:]
 	y[0] = byte(l)
-	copy(y[1:], strings.Bytes(m.proto[0:l]))
+	copy(y[1:], []byte(m.proto[0:l]))
 	y = y[1+l:]
 	y[0] = byte(padding)
 

src/pkg/crypto/tls/prf.go

@@ -10,7 +10,6 @@ import (
 	"crypto/sha1"
 	"hash"
 	"os"
-	"strings"
 )
 
 // Split a premaster secret in two as specified in RFC 4346, section 5.
@@ -70,10 +69,10 @@ const (
 	finishedVerifyLength = 12 // Length of verify_data in a Finished message.
 )
 
-var masterSecretLabel = strings.Bytes("master secret")
+var masterSecretLabel = []byte("master secret")
-var keyExpansionLabel = strings.Bytes("key expansion")
+var keyExpansionLabel = []byte("key expansion")
-var clientFinishedLabel = strings.Bytes("client finished")
+var clientFinishedLabel = []byte("client finished")
-var serverFinishedLabel = strings.Bytes("server finished")
+var serverFinishedLabel = []byte("server finished")
 
 // keysFromPreMasterSecret generates the connection keys from the pre master
 // secret, given the lengths of the MAC and cipher keys, as defined in RFC

src/pkg/crypto/x509/x509.go

@@ -735,7 +735,7 @@ func buildExtensions(template *Certificate) (ret []extension, err os.Error) {
 		ret[n].Id = oidExtensionSubjectAltName
 		rawValues := make([]asn1.RawValue, len(template.DNSNames))
 		for i, name := range template.DNSNames {
-			rawValues[i] = asn1.RawValue{Tag: 2, Class: 2, Bytes: strings.Bytes(name)}
+			rawValues[i] = asn1.RawValue{Tag: 2, Class: 2, Bytes: []byte(name)}
 		}
 		ret[n].Value, err = asn1.MarshalToMemory(rawValues)
 		if err != nil {

src/pkg/crypto/x509/x509_test.go

@@ -11,13 +11,12 @@ import (
 	"encoding/pem"
 	"os"
 	"reflect"
-	"strings"
 	"testing"
 	"time"
 )
 
 func TestParsePKCS1PrivateKey(t *testing.T) {
-	block, _ := pem.Decode(strings.Bytes(pemPrivateKey))
+	block, _ := pem.Decode([]byte(pemPrivateKey))
 	priv, err := ParsePKCS1PrivateKey(block.Bytes)
 	if err != nil {
 		t.Errorf("Failed to parse private key: %s", err)
@@ -151,7 +150,7 @@ func TestCreateSelfSignedCertificate(t *testing.T) {
 		t.Errorf("failed to open /dev/urandom")
 	}
 
-	block, _ := pem.Decode(strings.Bytes(pemPrivateKey))
+	block, _ := pem.Decode([]byte(pemPrivateKey))
 	priv, err := ParsePKCS1PrivateKey(block.Bytes)
 	if err != nil {
 		t.Errorf("Failed to parse private key: %s", err)

src/pkg/ebnf/ebnf_test.go

@@ -6,7 +6,6 @@ package ebnf
 
 import (
 	"io/ioutil"
-	"strings"
 	"testing"
 )
 
@@ -53,7 +52,7 @@ func check(t *testing.T, filename string, src []byte) {
 
 func TestGrammars(t *testing.T) {
 	for _, src := range grammars {
-		check(t, "", strings.Bytes(src))
+		check(t, "", []byte(src))
 	}
 }
 

src/pkg/encoding/ascii85/ascii85_test.go

@@ -8,7 +8,6 @@ import (
 	"bytes"
 	"io/ioutil"
 	"os"
-	"strings"
 	"testing"
 )
 
@@ -57,7 +56,7 @@ func strip85(s string) string {
 func TestEncode(t *testing.T) {
 	for _, p := range pairs {
 		buf := make([]byte, MaxEncodedLen(len(p.decoded)))
-		n := Encode(buf, strings.Bytes(p.decoded))
+		n := Encode(buf, []byte(p.decoded))
 		buf = buf[0:n]
 		testEqual(t, "Encode(%q) = %q, want %q", p.decoded, strip85(string(buf)), strip85(p.encoded))
 	}
@@ -67,14 +66,14 @@ func TestEncoder(t *testing.T) {
 	for _, p := range pairs {
 		bb := &bytes.Buffer{}
 		encoder := NewEncoder(bb)
-		encoder.Write(strings.Bytes(p.decoded))
+		encoder.Write([]byte(p.decoded))
 		encoder.Close()
 		testEqual(t, "Encode(%q) = %q, want %q", p.decoded, strip85(bb.String()), strip85(p.encoded))
 	}
 }
 
 func TestEncoderBuffering(t *testing.T) {
-	input := strings.Bytes(bigtest.decoded)
+	input := []byte(bigtest.decoded)
 	for bs := 1; bs <= 12; bs++ {
 		bb := &bytes.Buffer{}
 		encoder := NewEncoder(bb)
@@ -96,7 +95,7 @@ func TestEncoderBuffering(t *testing.T) {
 func TestDecode(t *testing.T) {
 	for _, p := range pairs {
 		dbuf := make([]byte, 4*len(p.encoded))
-		ndst, nsrc, err := Decode(dbuf, strings.Bytes(p.encoded), true)
+		ndst, nsrc, err := Decode(dbuf, []byte(p.encoded), true)
 		testEqual(t, "Decode(%q) = error %v, want %v", p.encoded, err, os.Error(nil))
 		testEqual(t, "Decode(%q) = nsrc %v, want %v", p.encoded, nsrc, len(p.encoded))
 		testEqual(t, "Decode(%q) = ndst %v, want %v", p.encoded, ndst, len(p.decoded))
@@ -145,7 +144,7 @@ func TestDecodeCorrupt(t *testing.T) {
 
 	for _, e := range examples {
 		dbuf := make([]byte, 4*len(e.e))
-		_, _, err := Decode(dbuf, strings.Bytes(e.e), true)
+		_, _, err := Decode(dbuf, []byte(e.e), true)
 		switch err := err.(type) {
 		case CorruptInputError:
 			testEqual(t, "Corruption in %q at offset %v, want %v", e.e, int(err), e.p)

src/pkg/encoding/base64/base64_test.go

@@ -8,7 +8,6 @@ import (
 	"bytes"
 	"io/ioutil"
 	"os"
-	"strings"
 	"testing"
 )
 
@@ -58,7 +57,7 @@ func testEqual(t *testing.T, msg string, args ...interface{}) bool {
 func TestEncode(t *testing.T) {
 	for _, p := range pairs {
 		buf := make([]byte, StdEncoding.EncodedLen(len(p.decoded)))
-		StdEncoding.Encode(buf, strings.Bytes(p.decoded))
+		StdEncoding.Encode(buf, []byte(p.decoded))
 		testEqual(t, "Encode(%q) = %q, want %q", p.decoded, string(buf), p.encoded)
 	}
 }
@@ -67,14 +66,14 @@ func TestEncoder(t *testing.T) {
 	for _, p := range pairs {
 		bb := &bytes.Buffer{}
 		encoder := NewEncoder(StdEncoding, bb)
-		encoder.Write(strings.Bytes(p.decoded))
+		encoder.Write([]byte(p.decoded))
 		encoder.Close()
 		testEqual(t, "Encode(%q) = %q, want %q", p.decoded, bb.String(), p.encoded)
 	}
 }
 
 func TestEncoderBuffering(t *testing.T) {
-	input := strings.Bytes(bigtest.decoded)
+	input := []byte(bigtest.decoded)
 	for bs := 1; bs <= 12; bs++ {
 		bb := &bytes.Buffer{}
 		encoder := NewEncoder(StdEncoding, bb)
@@ -96,7 +95,7 @@ func TestEncoderBuffering(t *testing.T) {
 func TestDecode(t *testing.T) {
 	for _, p := range pairs {
 		dbuf := make([]byte, StdEncoding.DecodedLen(len(p.encoded)))
-		count, end, err := StdEncoding.decode(dbuf, strings.Bytes(p.encoded))
+		count, end, err := StdEncoding.decode(dbuf, []byte(p.encoded))
 		testEqual(t, "Decode(%q) = error %v, want %v", p.encoded, err, os.Error(nil))
 		testEqual(t, "Decode(%q) = length %v, want %v", p.encoded, count, len(p.decoded))
 		if len(p.encoded) > 0 {
@@ -153,7 +152,7 @@ func TestDecodeCorrupt(t *testing.T) {
 
 	for _, e := range examples {
 		dbuf := make([]byte, StdEncoding.DecodedLen(len(e.e)))
-		_, err := StdEncoding.Decode(dbuf, strings.Bytes(e.e))
+		_, err := StdEncoding.Decode(dbuf, []byte(e.e))
 		switch err := err.(type) {
 		case CorruptInputError:
 			testEqual(t, "Corruption in %q at offset %v, want %v", e.e, int(err), e.p)

src/pkg/encoding/git85/git_test.go

@@ -8,7 +8,6 @@ import (
 	"bytes"
 	"io/ioutil"
 	"os"
-	"strings"
 	"testing"
 )
 
@@ -61,7 +60,7 @@ var gitBigtest = gitPairs[len(gitPairs)-1]
 func TestEncode(t *testing.T) {
 	for _, p := range gitPairs {
 		buf := make([]byte, EncodedLen(len(p.decoded)))
-		n := Encode(buf, strings.Bytes(p.decoded))
+		n := Encode(buf, []byte(p.decoded))
 		if n != len(buf) {
 			t.Errorf("EncodedLen does not agree with Encode")
 		}
@@ -74,14 +73,14 @@ func TestEncoder(t *testing.T) {
 	for _, p := range gitPairs {
 		bb := &bytes.Buffer{}
 		encoder := NewEncoder(bb)
-		encoder.Write(strings.Bytes(p.decoded))
+		encoder.Write([]byte(p.decoded))
 		encoder.Close()
 		testEqual(t, "Encode(%q) = %q, want %q", p.decoded, bb.String(), p.encoded)
 	}
 }
 
 func TestEncoderBuffering(t *testing.T) {
-	input := strings.Bytes(gitBigtest.decoded)
+	input := []byte(gitBigtest.decoded)
 	for bs := 1; bs <= 12; bs++ {
 		bb := &bytes.Buffer{}
 		encoder := NewEncoder(bb)
@@ -103,7 +102,7 @@ func TestEncoderBuffering(t *testing.T) {
 func TestDecode(t *testing.T) {
 	for _, p := range gitPairs {
 		dbuf := make([]byte, 4*len(p.encoded))
-		ndst, err := Decode(dbuf, strings.Bytes(p.encoded))
+		ndst, err := Decode(dbuf, []byte(p.encoded))
 		testEqual(t, "Decode(%q) = error %v, want %v", p.encoded, err, os.Error(nil))
 		testEqual(t, "Decode(%q) = ndst %v, want %v", p.encoded, ndst, len(p.decoded))
 		testEqual(t, "Decode(%q) = %q, want %q", p.encoded, string(dbuf[0:ndst]), p.decoded)
@@ -151,7 +150,7 @@ func TestDecodeCorrupt(t *testing.T) {
 
 	for _, e := range examples {
 		dbuf := make([]byte, 2*len(e.e))
-		_, err := Decode(dbuf, strings.Bytes(e.e))
+		_, err := Decode(dbuf, []byte(e.e))
 		switch err := err.(type) {
 		case CorruptInputError:
 			testEqual(t, "Corruption in %q at offset %v, want %v", e.e, int(err), e.p)

src/pkg/encoding/hex/hex.go

@@ -8,7 +8,6 @@ package hex
 import (
 	"os"
 	"strconv"
-	"strings"
 )
 
 const hextable = "0123456789abcdef"
@@ -92,7 +91,7 @@ func EncodeToString(src []byte) string {
 
 // DecodeString returns the bytes represented by the hexadecimal string s.
 func DecodeString(s string) ([]byte, os.Error) {
-	src := strings.Bytes(s)
+	src := []byte(s)
 	dst := make([]byte, DecodedLen(len(src)))
 	_, err := Decode(dst, src)
 	if err != nil {

src/pkg/encoding/pem/pem.go

@@ -12,7 +12,6 @@ import (
 	"encoding/base64"
 	"io"
 	"os"
-	"strings"
 )
 
 // A Block represents a PEM encoded structure.
@@ -65,9 +64,9 @@ func removeWhitespace(data []byte) []byte {
 	return result[0:n]
 }
 
-var pemStart = strings.Bytes("\n-----BEGIN ")
+var pemStart = []byte("\n-----BEGIN ")
-var pemEnd = strings.Bytes("\n-----END ")
+var pemEnd = []byte("\n-----END ")
-var pemEndOfLine = strings.Bytes("-----")
+var pemEndOfLine = []byte("-----")
 
 // Decode will find the next PEM formatted block (certificate, private key
 // etc) in the input. It returns that block and the remainder of the input. If
@@ -214,13 +213,13 @@ func Encode(out io.Writer, b *Block) (err os.Error) {
 	if err != nil {
 		return
 	}
-	_, err = out.Write(strings.Bytes(b.Type + "-----\n"))
+	_, err = out.Write([]byte(b.Type + "-----\n"))
 	if err != nil {
 		return
 	}
 
 	for k, v := range b.Headers {
-		_, err = out.Write(strings.Bytes(k + ": " + v + "\n"))
+		_, err = out.Write([]byte(k + ": " + v + "\n"))
 		if err != nil {
 			return
 		}
@@ -248,7 +247,7 @@ func Encode(out io.Writer, b *Block) (err os.Error) {
 	if err != nil {
 		return
 	}
-	_, err = out.Write(strings.Bytes(b.Type + "-----\n"))
+	_, err = out.Write([]byte(b.Type + "-----\n"))
 	return
 }
 

src/pkg/encoding/pem/pem_test.go

@@ -7,7 +7,6 @@ package pem
 import (
 	"bytes"
 	"reflect"
-	"strings"
 	"testing"
 )
 
@@ -28,7 +27,7 @@ var getLineTests = []GetLineTest{
 
 func TestGetLine(t *testing.T) {
 	for i, test := range getLineTests {
-		x, y := getLine(strings.Bytes(test.in))
+		x, y := getLine([]byte(test.in))
 		if string(x) != test.out1 || string(y) != test.out2 {
 			t.Errorf("#%d got:%+v,%+v want:%s,%s", i, x, y, test.out1, test.out2)
 		}
@@ -36,7 +35,7 @@ func TestGetLine(t *testing.T) {
 }
 
 func TestDecode(t *testing.T) {
-	result, remainder := Decode(strings.Bytes(pemData))
+	result, remainder := Decode([]byte(pemData))
 	if !reflect.DeepEqual(result, certificate) {
 		t.Errorf("#0 got:%#v want:%#v", result, certificate)
 	}
@@ -44,7 +43,7 @@ func TestDecode(t *testing.T) {
 	if !reflect.DeepEqual(result, privateKey) {
 		t.Errorf("#1 got:%#v want:%#v", result, privateKey)
 	}
-	result, _ = Decode(strings.Bytes(pemPrivateKey))
+	result, _ = Decode([]byte(pemPrivateKey))
 	if !reflect.DeepEqual(result, privateKey2) {
 		t.Errorf("#2 got:%#v want:%#v", result, privateKey2)
 	}
@@ -77,7 +76,7 @@ func TestLineBreaker(t *testing.T) {
 		buf := bytes.NewBuffer(nil)
 		var breaker lineBreaker
 		breaker.out = buf
-		_, err := breaker.Write(strings.Bytes(test.in))
+		_, err := breaker.Write([]byte(test.in))
 		if err != nil {
 			t.Errorf("#%d: error from Write: %s", i, err)
 			continue
@@ -99,7 +98,7 @@ func TestLineBreaker(t *testing.T) {
 		breaker.out = buf
 
 		for i := 0; i < len(test.in); i++ {
-			_, err := breaker.Write(strings.Bytes(test.in[i : i+1]))
+			_, err := breaker.Write([]byte(test.in[i : i+1]))
 			if err != nil {
 				t.Errorf("#%d: error from Write (byte by byte): %s", i, err)
 				continue

src/pkg/exp/datafmt/datafmt_test.go

@@ -6,13 +6,12 @@ package datafmt
 
 import (
 	"fmt"
-	"strings"
 	"testing"
 )
 
 
 func parse(t *testing.T, form string, fmap FormatterMap) Format {
-	f, err := Parse("", strings.Bytes(form), fmap)
+	f, err := Parse("", []byte(form), fmap)
 	if err != nil {
 		t.Errorf("Parse(%s): %v", form, err)
 		return nil
@@ -52,7 +51,7 @@ func formatter(s *State, value interface{}, rule_name string) bool {
 	case "nil":
 		return false
 	case "testing.T":
-		s.Write(strings.Bytes("testing.T"))
+		s.Write([]byte("testing.T"))
 		return true
 	}
 	panic("unreachable")

src/pkg/exp/datafmt/parser.go

@@ -137,7 +137,7 @@ func (p *parser) parseString() string {
 
 
 func (p *parser) parseLiteral() literal {
-	s := strings.Bytes(p.parseString())
+	s := []byte(p.parseString())
 
 	// A string literal may contain %-format specifiers. To simplify
 	// and speed up printing of the literal, split it into segments

src/pkg/exp/spacewar/spacewar.go

@@ -32,7 +32,6 @@ import (
 	"log"
 	"os"
 	"runtime"
-	"strings"
 	"time"
 	"./pdp1"
 )
@@ -53,7 +52,7 @@ func main() {
 	var m SpacewarPDP1
 	m.Init(w)
 	m.PC = 4
-	f := bytes.NewBuffer(strings.Bytes(spacewarCode))
+	f := bytes.NewBuffer([]byte(spacewarCode))
 	if err = m.Load(f); err != nil {
 		log.Exitf("loading %s: %s", "spacewar.lst", err)
 	}

src/pkg/fmt/fmt_test.go

@@ -66,12 +66,12 @@ var fmttests = []fmtTest{
 	fmtTest{"%q", "abc", `"abc"`},
 
 	// basic bytes
-	fmtTest{"%s", strings.Bytes("abc"), "abc"},
+	fmtTest{"%s", []byte("abc"), "abc"},
-	fmtTest{"%x", strings.Bytes("abc"), "616263"},
+	fmtTest{"%x", []byte("abc"), "616263"},
-	fmtTest{"% x", strings.Bytes("abc"), "61 62 63"},
+	fmtTest{"% x", []byte("abc"), "61 62 63"},
-	fmtTest{"%x", strings.Bytes("xyz"), "78797a"},
+	fmtTest{"%x", []byte("xyz"), "78797a"},
-	fmtTest{"%X", strings.Bytes("xyz"), "78797A"},
+	fmtTest{"%X", []byte("xyz"), "78797A"},
-	fmtTest{"%q", strings.Bytes("abc"), `"abc"`},
+	fmtTest{"%q", []byte("abc"), `"abc"`},
 
 	// escaped strings
 	fmtTest{"%#q", `abc`, "`abc`"},

src/pkg/go/doc/comment.go

@@ -123,8 +123,8 @@ func split(text []byte) [][]byte {
 
 
 var (
-	ldquo = strings.Bytes("“")
+	ldquo = []byte("“")
-	rdquo = strings.Bytes("”")
+	rdquo = []byte("”")
 )
 
 // Escape comment text for HTML.
@@ -149,10 +149,10 @@ func commentEscape(w io.Writer, s []byte) {
 
 
 var (
-	html_p      = strings.Bytes("<p>\n")
+	html_p      = []byte("<p>\n")
-	html_endp   = strings.Bytes("</p>\n")
+	html_endp   = []byte("</p>\n")
-	html_pre    = strings.Bytes("<pre>")
+	html_pre    = []byte("<pre>")
-	html_endpre = strings.Bytes("</pre>\n")
+	html_endpre = []byte("</pre>\n")
 )
 
 

src/pkg/go/parser/interface.go

@@ -15,7 +15,6 @@ import (
 	"io/ioutil"
 	"os"
 	pathutil "path"
-	"strings"
 )
 
 
@@ -27,7 +26,7 @@ func readSource(filename string, src interface{}) ([]byte, os.Error) {
 	if src != nil {
 		switch s := src.(type) {
 		case string:
-			return strings.Bytes(s), nil
+			return []byte(s), nil
 		case []byte:
 			return s, nil
 		case *bytes.Buffer:

src/pkg/go/printer/nodes.go

@@ -12,7 +12,6 @@ import (
 	"bytes"
 	"go/ast"
 	"go/token"
-	"strings"
 )
 
 
@@ -286,7 +285,7 @@ func (p *printer) isOneLineFieldList(list []*ast.Field) bool {
 
 
 func (p *printer) setLineComment(text string) {
-	p.setComment(&ast.CommentGroup{[]*ast.Comment{&ast.Comment{noPos, strings.Bytes(text)}}})
+	p.setComment(&ast.CommentGroup{[]*ast.Comment{&ast.Comment{noPos, []byte(text)}}})
 }
 
 

src/pkg/go/printer/printer.go

@@ -14,7 +14,6 @@ import (
 	"os"
 	"reflect"
 	"runtime"
-	"strings"
 	"tabwriter"
 )
 
@@ -45,11 +44,11 @@ var (
 	newlines  = [...]byte{'\n', '\n', '\n', '\n', '\n', '\n', '\n', '\n'} // more than maxNewlines
 	formfeeds = [...]byte{'\f', '\f', '\f', '\f', '\f', '\f', '\f', '\f'} // more than maxNewlines
 
-	esc_quot = strings.Bytes(""") // shorter than """
+	esc_quot = []byte(""") // shorter than """
-	esc_apos = strings.Bytes("'") // shorter than "'"
+	esc_apos = []byte("'") // shorter than "'"
-	esc_amp  = strings.Bytes("&")
+	esc_amp  = []byte("&")
-	esc_lt   = strings.Bytes("<")
+	esc_lt   = []byte("<")
-	esc_gt   = strings.Bytes(">")
+	esc_gt   = []byte(">")
 )
 
 
@@ -223,12 +222,12 @@ func (p *printer) writeTaggedItem(data []byte, tag HTMLTag) {
 	// write start tag, if any
 	// (no html-escaping and no p.pos update for tags - use write0)
 	if tag.Start != "" {
-		p.write0(strings.Bytes(tag.Start))
+		p.write0([]byte(tag.Start))
 	}
 	p.write(data)
 	// write end tag, if any
 	if tag.End != "" {
-		p.write0(strings.Bytes(tag.End))
+		p.write0([]byte(tag.End))
 	}
 }
 
@@ -247,7 +246,7 @@ func (p *printer) writeItem(pos token.Position, data []byte, tag HTMLTag) {
 	}
 	if debug {
 		// do not update p.pos - use write0
-		p.write0(strings.Bytes(fmt.Sprintf("[%d:%d]", pos.Line, pos.Column)))
+		p.write0([]byte(fmt.Sprintf("[%d:%d]", pos.Line, pos.Column)))
 	}
 	if p.Mode&GenHTML != 0 {
 		// write line tag if on a new line
@@ -744,7 +743,7 @@ func (p *printer) print(args ...) {
 			if p.Styler != nil {
 				data, tag = p.Styler.Ident(x)
 			} else {
-				data = strings.Bytes(x.Name())
+				data = []byte(x.Name())
 			}
 		case *ast.BasicLit:
 			if p.Styler != nil {
@@ -756,12 +755,12 @@ func (p *printer) print(args ...) {
 			// (note that valid Go programs cannot contain esc ('\xff')
 			// bytes since they do not appear in legal UTF-8 sequences)
 			// TODO(gri): do this more efficiently.
-			data = strings.Bytes("\xff" + string(data) + "\xff")
+			data = []byte("\xff" + string(data) + "\xff")
 		case token.Token:
 			if p.Styler != nil {
 				data, tag = p.Styler.Token(x)
 			} else {
-				data = strings.Bytes(x.String())
+				data = []byte(x.String())
 			}
 			isKeyword = x.IsKeyword()
 		case token.Position:

src/pkg/go/scanner/scanner_test.go

@@ -7,7 +7,6 @@ package scanner
 import (
 	"go/token"
 	"os"
-	"strings"
 	"testing"
 )
 
@@ -225,7 +224,7 @@ func TestScan(t *testing.T) {
 	// verify scan
 	index := 0
 	epos := token.Position{"", 0, 1, 1}
-	nerrors := Tokenize("", strings.Bytes(src), &testErrorHandler{t}, ScanComments,
+	nerrors := Tokenize("", []byte(src), &testErrorHandler{t}, ScanComments,
 		func(pos token.Position, tok token.Token, litb []byte) bool {
 			e := elt{token.EOF, "", special}
 			if index < len(tokens) {
@@ -264,7 +263,7 @@ func TestScan(t *testing.T) {
 
 func checkSemi(t *testing.T, line string, mode uint) {
 	var S Scanner
-	S.Init("TestSemis", strings.Bytes(line), nil, mode)
+	S.Init("TestSemis", []byte(line), nil, mode)
 	pos, tok, lit := S.Scan()
 	for tok != token.EOF {
 		if tok == token.ILLEGAL {
@@ -451,7 +450,7 @@ func TestLineComments(t *testing.T) {
 
 	// verify scan
 	var S Scanner
-	S.Init("TestLineComments", strings.Bytes(src), nil, 0)
+	S.Init("TestLineComments", []byte(src), nil, 0)
 	for _, s := range segments {
 		pos, _, lit := S.Scan()
 		checkPos(t, string(lit), pos, token.Position{s.filename, pos.Offset, s.line, pos.Column})
@@ -468,7 +467,7 @@ func TestInit(t *testing.T) {
 	var s Scanner
 
 	// 1st init
-	s.Init("", strings.Bytes("if true { }"), nil, 0)
+	s.Init("", []byte("if true { }"), nil, 0)
 	s.Scan()              // if
 	s.Scan()              // true
 	_, tok, _ := s.Scan() // {
@@ -477,7 +476,7 @@ func TestInit(t *testing.T) {
 	}
 
 	// 2nd init
-	s.Init("", strings.Bytes("go true { ]"), nil, 0)
+	s.Init("", []byte("go true { ]"), nil, 0)
 	_, tok, _ = s.Scan() // go
 	if tok != token.GO {
 		t.Errorf("bad token: got %s, expected %s", tok.String(), token.GO)
@@ -493,7 +492,7 @@ func TestIllegalChars(t *testing.T) {
 	var s Scanner
 
 	const src = "*?*$*@*"
-	s.Init("", strings.Bytes(src), &testErrorHandler{t}, AllowIllegalChars)
+	s.Init("", []byte(src), &testErrorHandler{t}, AllowIllegalChars)
 	for offs, ch := range src {
 		pos, tok, lit := s.Scan()
 		if pos.Offset != offs {
@@ -521,7 +520,7 @@ func TestStdErrorHander(t *testing.T) {
 		"@ @ @" // original file, line 1 again
 
 	v := new(ErrorVector)
-	nerrors := Tokenize("File1", strings.Bytes(src), v, 0,
+	nerrors := Tokenize("File1", []byte(src), v, 0,
 		func(pos token.Position, tok token.Token, litb []byte) bool {
 			return tok != token.EOF
 		})
@@ -567,7 +566,7 @@ func (h *errorCollector) Error(pos token.Position, msg string) {
 func checkError(t *testing.T, src string, tok token.Token, pos int, err string) {
 	var s Scanner
 	var h errorCollector
-	s.Init("", strings.Bytes(src), &h, ScanComments)
+	s.Init("", []byte(src), &h, ScanComments)
 	_, tok0, _ := s.Scan()
 	_, tok1, _ := s.Scan()
 	if tok0 != tok {

src/pkg/gob/codec_test.go

@@ -298,7 +298,7 @@ func TestScalarEncInstructions(t *testing.T) {
 	// bytes == []uint8
 	{
 		b.Reset()
-		data := struct{ a []byte }{strings.Bytes("hello")}
+		data := struct{ a []byte }{[]byte("hello")}
 		instr := &encInstr{encUint8Array, 6, 0, 0}
 		state := newencoderState(b)
 		instr.op(instr, state, unsafe.Pointer(&data))
@@ -587,7 +587,7 @@ func TestEndToEnd(t *testing.T) {
 		strs: &[2]string{s1, s2},
 		int64s: &[]int64{77, 89, 123412342134},
 		s: "Now is the time",
-		y: strings.Bytes("hello, sailor"),
+		y: []byte("hello, sailor"),
 		t: &T2{"this is T2"},
 	}
 	b := new(bytes.Buffer)
@@ -935,7 +935,7 @@ func TestIgnoredFields(t *testing.T) {
 	it0.ignore_e[2] = 3.0
 	it0.ignore_f = true
 	it0.ignore_g = "pay no attention"
-	it0.ignore_h = strings.Bytes("to the curtain")
+	it0.ignore_h = []byte("to the curtain")
 	it0.ignore_i = &RT1{3.1, "hi", 7, "hello"}
 
 	b := new(bytes.Buffer)

src/pkg/http/client.go

@@ -46,7 +46,7 @@ func send(req *Request) (resp *Response, err os.Error) {
 	if len(info) > 0 {
 		enc := base64.URLEncoding
 		encoded := make([]byte, enc.EncodedLen(len(info)))
-		enc.Encode(encoded, strings.Bytes(info))
+		enc.Encode(encoded, []byte(info))
 		if req.Header == nil {
 			req.Header = make(map[string]string)
 		}

src/pkg/http/lex.go

@@ -4,10 +4,6 @@
 
 package http
 
-import (
-	"strings"
-)
-
 // This file deals with lexical matters of HTTP
 
 func isSeparator(c byte) bool {
@@ -112,7 +108,7 @@ func httpUnquote(raw []byte) (eaten int, result string) {
 // the input string might be parsed. result is always non-nil.
 func httpSplitFieldValue(fv string) (eaten int, result []string) {
 	result = make([]string, 0, len(fv))
-	raw := strings.Bytes(fv)
+	raw := []byte(fv)
 	i := 0
 	chunk := ""
 	for i < len(raw) {

src/pkg/http/request.go

@@ -376,7 +376,7 @@ func CanonicalHeaderKey(s string) string {
 	// and upper case after each dash.
 	// (Host, User-Agent, If-Modified-Since).
 	// HTTP headers are ASCII only, so no Unicode issues.
-	a := strings.Bytes(s)
+	a := []byte(s)
 	upper := true
 	for i, v := range a {
 		if upper && 'a' <= v && v <= 'z' {

src/pkg/http/url.go

@@ -70,7 +70,7 @@ func shouldEscape(c byte) bool {
 // CanonicalPath applies the algorithm specified in RFC 2396 to
 // simplify the path, removing unnecessary  . and .. elements.
 func CanonicalPath(path string) string {
-	buf := strings.Bytes(path)
+	buf := []byte(path)
 	a := buf[0:0]
 	// state helps to find /.. ^.. ^. and /. patterns.
 	// state == 1 - prev char is '/' or beginning of the string.

src/pkg/io/io.go

@@ -8,10 +8,7 @@
 // abstract the functionality, plus some other related primitives.
 package io
 
-import (
+import "os"
-	"os"
-	"strings"
-)
 
 // Error represents an unexpected I/O behavior.
 type Error struct {
@@ -160,7 +157,7 @@ type ReadByter interface {
 
 // WriteString writes the contents of the string s to w, which accepts an array of bytes.
 func WriteString(w Writer, s string) (n int, err os.Error) {
-	return w.Write(strings.Bytes(s))
+	return w.Write([]byte(s))
 }
 
 // ReadAtLeast reads from r into buf until it has read at least min bytes.

src/pkg/io/ioutil/ioutil_test.go

@@ -7,7 +7,6 @@ package ioutil_test
 import (
 	. "io/ioutil"
 	"os"
-	"strings"
 	"testing"
 )
 
@@ -43,7 +42,7 @@ func TestWriteFile(t *testing.T) {
 		"build bigger and better idiot-proof programs, and the Universe trying " +
 		"to produce bigger and better idiots. So far, the Universe is winning."
 
-	if err := WriteFile(filename, strings.Bytes(data), 0644); err != nil {
+	if err := WriteFile(filename, []byte(data), 0644); err != nil {
 		t.Fatalf("WriteFile %s: %v", filename, err)
 	}
 

src/pkg/io/pipe_test.go

@@ -8,7 +8,6 @@ import (
 	"fmt"
 	. "io"
 	"os"
-	"strings"
 	"testing"
 	"time"
 )
@@ -29,7 +28,7 @@ func TestPipe1(t *testing.T) {
 	c := make(chan int)
 	r, w := Pipe()
 	var buf = make([]byte, 64)
-	go checkWrite(t, w, strings.Bytes("hello, world"), c)
+	go checkWrite(t, w, []byte("hello, world"), c)
 	n, err := r.Read(buf)
 	if err != nil {
 		t.Errorf("read: %v", err)

src/pkg/net/dialgoogle_test.go

@@ -7,7 +7,6 @@ package net
 import (
 	"flag"
 	"io"
-	"strings"
 	"syscall"
 	"testing"
 )
@@ -18,7 +17,7 @@ var ipv6 = flag.Bool("ipv6", false, "assume ipv6 tunnel is present")
 // fd is already connected to the destination, port 80.
 // Run an HTTP request to fetch the appropriate page.
 func fetchGoogle(t *testing.T, fd Conn, network, addr string) {
-	req := strings.Bytes("GET /intl/en/privacy.html HTTP/1.0\r\nHost: www.google.com\r\n\r\n")
+	req := []byte("GET /intl/en/privacy.html HTTP/1.0\r\nHost: www.google.com\r\n\r\n")
 	n, err := fd.Write(req)
 
 	buf := make([]byte, 1000)

src/pkg/net/server_test.go

@@ -65,7 +65,7 @@ func connect(t *testing.T, network, addr string, isEmpty bool) {
 
 	var b []byte
 	if !isEmpty {
-		b = strings.Bytes("hello, world\n")
+		b = []byte("hello, world\n")
 	}
 	var b1 [100]byte
 

src/pkg/os/os_test.go

@@ -468,7 +468,7 @@ func TestTruncate(t *testing.T) {
 	}
 
 	checkSize(t, Path, 0)
-	fd.Write(strings.Bytes("hello, world\n"))
+	fd.Write([]byte("hello, world\n"))
 	checkSize(t, Path, 13)
 	fd.Truncate(10)
 	checkSize(t, Path, 10)
@@ -476,7 +476,7 @@ func TestTruncate(t *testing.T) {
 	checkSize(t, Path, 1024)
 	fd.Truncate(0)
 	checkSize(t, Path, 0)
-	fd.Write(strings.Bytes("surprise!"))
+	fd.Write([]byte("surprise!"))
 	checkSize(t, Path, 13+9) // wrote at offset past where hello, world was.
 	fd.Close()
 	Remove(Path)
@@ -688,7 +688,7 @@ func TestWriteAt(t *testing.T) {
 	const data = "hello, world\n"
 	io.WriteString(f, data)
 
-	n, err := f.WriteAt(strings.Bytes("WORLD"), 7)
+	n, err := f.WriteAt([]byte("WORLD"), 7)
 	if err != nil || n != 5 {
 		t.Fatalf("WriteAt 7: %d, %v", n, err)
 	}

src/pkg/patch/patch_test.go

@@ -6,10 +6,7 @@ package patch
 
 // TODO(rsc): test Apply
 
-import (
+import "testing"
-	"strings"
-	"testing"
-)
 
 type Test struct {
 	in   string
@@ -19,7 +16,7 @@ type Test struct {
 
 func TestFileApply(t *testing.T) {
 	for i, test := range tests {
-		set, err := Parse(strings.Bytes(test.diff))
+		set, err := Parse([]byte(test.diff))
 		if err != nil {
 			t.Errorf("#%d: Parse: %s", i, err)
 			continue
@@ -28,7 +25,7 @@ func TestFileApply(t *testing.T) {
 			t.Errorf("#%d: Parse returned %d patches, want 1", i, len(set.File))
 			continue
 		}
-		new, err := set.File[0].Apply(strings.Bytes(test.in))
+		new, err := set.File[0].Apply([]byte(test.in))
 		if err != nil {
 			t.Errorf("#%d: Apply: %s", i, err)
 			continue

src/pkg/path/path.go

@@ -42,7 +42,7 @@ func Clean(path string) string {
 	//	writing to buf; w is index of next byte to write.
 	//	dotdot is index in buf where .. must stop, either because
 	//		it is the leading slash or it is a leading ../../.. prefix.
-	buf := strings.Bytes(path)
+	buf := []byte(path)
 	r, w, dotdot := 0, 0, 0
 	if rooted {
 		r, w, dotdot = 1, 1, 1

src/pkg/regexp/all_test.go

@@ -161,7 +161,7 @@ func executeTest(t *testing.T, expr string, str string, match []int) {
 		printVec(t, match)
 	}
 	// now try bytes
-	m = re.Execute(strings.Bytes(str))
+	m = re.Execute([]byte(str))
 	if !equal(m, match) {
 		t.Errorf("Execute failure on %#q matching %q:", expr, str)
 		printVec(t, m)
@@ -199,7 +199,7 @@ func matchTest(t *testing.T, expr string, str string, match []int) {
 		t.Errorf("MatchString failure on %#q matching %q: %t should be %t", expr, str, m, len(match) > 0)
 	}
 	// now try bytes
-	m = re.Match(strings.Bytes(str))
+	m = re.Match([]byte(str))
 	if m != (len(match) > 0) {
 		t.Errorf("Match failure on %#q matching %q: %t should be %t", expr, str, m, len(match) > 0)
 	}
@@ -315,7 +315,7 @@ func TestReplaceAll(t *testing.T) {
 				tc.pattern, tc.input, tc.replacement, actual, tc.output)
 		}
 		// now try bytes
-		actual = string(re.ReplaceAll(strings.Bytes(tc.input), strings.Bytes(tc.replacement)))
+		actual = string(re.ReplaceAll([]byte(tc.input), []byte(tc.replacement)))
 		if actual != tc.output {
 			t.Errorf("%q.Replace(%q,%q) = %q; want %q",
 				tc.pattern, tc.input, tc.replacement, actual, tc.output)
@@ -419,7 +419,7 @@ func TestAllMatches(t *testing.T) {
 		case "matchit":
 			result = make([]string, len(c.input)+1)
 			i := 0
-			b := strings.Bytes(c.input)
+			b := []byte(c.input)
 			for match := range re.AllMatchesIter(b, c.n) {
 				result[i] = string(match)
 				i++
@@ -435,7 +435,7 @@ func TestAllMatches(t *testing.T) {
 			result = result[0:i]
 		case "match":
 			result = make([]string, len(c.input)+1)
-			b := strings.Bytes(c.input)
+			b := []byte(c.input)
 			i := 0
 			for _, match := range re.AllMatches(b, c.n) {
 				result[i] = string(match)

src/pkg/strings/strings.go

@@ -302,23 +302,3 @@ func TrimSpace(s string) string {
 	}
 	return s[start:end]
 }
-
-// Bytes returns a new slice containing the bytes in s.
-func Bytes(s string) []byte {
-	b := make([]byte, len(s))
-	for i := 0; i < len(s); i++ {
-		b[i] = s[i]
-	}
-	return b
-}
-
-// Runes returns a slice of runes (Unicode code points) equivalent to the string s.
-func Runes(s string) []int {
-	t := make([]int, utf8.RuneCountInString(s))
-	i := 0
-	for _, r := range s {
-		t[i] = r
-		i++
-	}
-	return t
-}

src/pkg/strings/strings_test.go

@@ -444,16 +444,16 @@ var RunesTests = []RunesTest{
 
 func TestRunes(t *testing.T) {
 	for _, tt := range RunesTests {
-		a := Runes(tt.in)
+		a := []int(tt.in)
 		if !runesEqual(a, tt.out) {
-			t.Errorf("Runes(%q) = %v; want %v", tt.in, a, tt.out)
+			t.Errorf("[]int(%q) = %v; want %v", tt.in, a, tt.out)
 			continue
 		}
 		if !tt.lossy {
 			// can only test reassembly if we didn't lose information
 			s := string(a)
 			if s != tt.in {
-				t.Errorf("string(Runes(%q)) = %x; want %x", tt.in, s, tt.in)
+				t.Errorf("string([]int(%q)) = %x; want %x", tt.in, s, tt.in)
 			}
 		}
 	}

src/pkg/template/format.go

@@ -10,7 +10,6 @@ import (
 	"bytes"
 	"fmt"
 	"io"
-	"strings"
 )
 
 // StringFormatter formats into the default string representation.
@@ -26,11 +25,11 @@ func StringFormatter(w io.Writer, value interface{}, format string) {
 }
 
 var (
-	esc_quot = strings.Bytes(""") // shorter than """
+	esc_quot = []byte(""") // shorter than """
-	esc_apos = strings.Bytes("'") // shorter than "'"
+	esc_apos = []byte("'") // shorter than "'"
-	esc_amp  = strings.Bytes("&")
+	esc_amp  = []byte("&")
-	esc_lt   = strings.Bytes("<")
+	esc_lt   = []byte("<")
-	esc_gt   = strings.Bytes(">")
+	esc_gt   = []byte(">")
 )
 
 // HTMLEscape writes to w the properly escaped HTML equivalent

src/pkg/template/template.go

@@ -915,7 +915,7 @@ func (t *Template) Parse(s string) os.Error {
 	if !validDelim(t.ldelim) || !validDelim(t.rdelim) {
 		return &Error{1, fmt.Sprintf("bad delimiter strings %q %q", t.ldelim, t.rdelim)}
 	}
-	t.buf = strings.Bytes(s)
+	t.buf = []byte(s)
 	t.p = 0
 	t.linenum = 1
 	t.parse()
@@ -942,8 +942,8 @@ func (t *Template) Execute(data interface{}, wr io.Writer) os.Error {
 // delimiters are very rarely invalid and Parse has the necessary
 // error-handling interface already.
 func (t *Template) SetDelims(left, right string) {
-	t.ldelim = strings.Bytes(left)
+	t.ldelim = []byte(left)
-	t.rdelim = strings.Bytes(right)
+	t.rdelim = []byte(right)
 }
 
 // Parse creates a Template with default parameters (such as {} for

src/pkg/template/template_test.go

@@ -9,7 +9,6 @@ import (
 	"container/vector"
 	"fmt"
 	"io"
-	"strings"
 	"testing"
 )
 
@@ -397,7 +396,7 @@ func TestAll(t *testing.T) {
 	s.stringmap = make(map[string]string)
 	s.stringmap["stringkey1"] = "stringresult" // the same value so repeated section is order-independent
 	s.stringmap["stringkey2"] = "stringresult"
-	s.bytes = strings.Bytes("hello")
+	s.bytes = []byte("hello")
 	s.iface = []int{1, 2, 3}
 
 	var buf bytes.Buffer

src/pkg/testing/regexp_test.go

@@ -4,10 +4,6 @@
 
 package testing
 
-import (
-	"strings"
-)
-
 var good_re = []string{
 	``,
 	`.`,
@@ -179,7 +175,7 @@ func executeTest(t *T, expr string, str string, match []int) {
 		printVec(t, match)
 	}
 	// now try bytes
-	m = re.Execute(strings.Bytes(str))
+	m = re.Execute([]byte(str))
 	if !equal(m, match) {
 		t.Error("Execute failure on `", expr, "` matching `", str, "`:")
 		printVec(t, m)
@@ -217,7 +213,7 @@ func matchTest(t *T, expr string, str string, match []int) {
 		t.Error("MatchString failure on `", expr, "` matching `", str, "`:", m, "should be", len(match) > 0)
 	}
 	// now try bytes
-	m = re.Match(strings.Bytes(str))
+	m = re.Match([]byte(str))
 	if m != (len(match) > 0) {
 		t.Error("Match failure on `", expr, "` matching `", str, "`:", m, "should be", len(match) > 0)
 	}
@@ -247,7 +243,7 @@ func matchStringsTest(t *T, expr string, str string, match []int) {
 		printStrings(t, strs)
 	}
 	// now try bytes
-	s := re.MatchSlices(strings.Bytes(str))
+	s := re.MatchSlices([]byte(str))
 	if !equalBytes(s, strs) {
 		t.Error("MatchSlices failure on `", expr, "` matching `", str, "`:")
 		printBytes(t, s)

src/pkg/utf8/utf8_test.go

@@ -6,7 +6,6 @@ package utf8_test
 
 import (
 	"bytes"
-	"strings"
 	"testing"
 	. "utf8"
 )
@@ -48,7 +47,7 @@ var utf8map = []Utf8Map{
 // strings.Bytes with one extra byte at end
 func makeBytes(s string) []byte {
 	s += "\x00"
-	b := strings.Bytes(s)
+	b := []byte(s)
 	return b[0 : len(s)-1]
 }
 
@@ -214,7 +213,7 @@ func BenchmarkDecodeASCIIRune(b *testing.B) {
 }
 
 func BenchmarkDecodeJapaneseRune(b *testing.B) {
-	nihon := strings.Bytes("本")
+	nihon := []byte("本")
 	for i := 0; i < b.N; i++ {
 		DecodeRune(nihon)
 	}

src/pkg/websocket/websocket_test.go

@@ -12,7 +12,6 @@ import (
 	"log"
 	"net"
 	"once"
-	"strings"
 	"testing"
 )
 
@@ -45,7 +44,7 @@ func TestEcho(t *testing.T) {
 		t.Errorf("WebSocket handshake error", err)
 		return
 	}
-	msg := strings.Bytes("hello, world\n")
+	msg := []byte("hello, world\n")
 	if _, err := ws.Write(msg); err != nil {
 		t.Errorf("Write: error %v", err)
 	}

src/pkg/xgb/xgb.go

@@ -173,7 +173,7 @@ func (c *Conn) sendBytes(buf []byte) {
 	c.sendPadding(len(buf))
 }
 
-func (c *Conn) sendString(str string) { c.sendBytes(strings.Bytes(str)) }
+func (c *Conn) sendString(str string) { c.sendBytes([]byte(str)) }
 
 // sendUInt32s sends a list of 32-bit integers as variable length data.
 func (c *Conn) sendUInt32List(list []uint32) {
@@ -318,7 +318,7 @@ func Dial(display string) (*Conn, os.Error) {
 	put16(buf[6:], uint16(len(authName)))
 	put16(buf[8:], uint16(len(authData)))
 	put16(buf[10:], 0)
-	copy(buf[12:], strings.Bytes(authName))
+	copy(buf[12:], []byte(authName))
 	copy(buf[12+pad(len(authName)):], authData)
 	if _, err = c.conn.Write(buf); err != nil {
 		return nil, err

src/pkg/xml/xml.go

@@ -815,7 +815,7 @@ Input:
 				p.err = SyntaxError("invalid character entity &" + s + ";")
 				return nil
 			}
-			p.buf.Write(strings.Bytes(text))
+			p.buf.Write([]byte(text))
 			b0, b1 = 0, 0
 			continue Input
 		}
@@ -1508,11 +1508,11 @@ var htmlAutoClose = []string{
 }
 
 var (
-	esc_quot = strings.Bytes(""") // shorter than """
+	esc_quot = []byte(""") // shorter than """
-	esc_apos = strings.Bytes("'") // shorter than "'"
+	esc_apos = []byte("'") // shorter than "'"
-	esc_amp  = strings.Bytes("&")
+	esc_amp  = []byte("&")
-	esc_lt   = strings.Bytes("<")
+	esc_lt   = []byte("<")
-	esc_gt   = strings.Bytes(">")
+	esc_gt   = []byte(">")
 )
 
 // Escape writes to w the properly escaped XML equivalent

src/pkg/xml/xml_test.go

@@ -9,7 +9,6 @@ import (
 	"io"
 	"os"
 	"reflect"
-	"strings"
 	"testing"
 )
 
@@ -30,69 +29,71 @@ const testInput = `
 </body><!-- missing final newline -->`
 
 var rawTokens = []Token{
-	CharData(strings.Bytes("\n")),
+	CharData([]byte("\n")),
-	ProcInst{"xml", strings.Bytes(`version="1.0" encoding="UTF-8"`)},
+	ProcInst{"xml", []byte(`version="1.0" encoding="UTF-8"`)},
-	CharData(strings.Bytes("\n")),
+	CharData([]byte("\n")),
-	Directive(strings.Bytes(`DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
+	Directive([]byte(`DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
-  "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"`)),
+  "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"`),
-	CharData(strings.Bytes("\n")),
+	),
+	CharData([]byte("\n")),
 	StartElement{Name{"", "body"}, []Attr{Attr{Name{"xmlns", "foo"}, "ns1"}, Attr{Name{"", "xmlns"}, "ns2"}, Attr{Name{"xmlns", "tag"}, "ns3"}}},
-	CharData(strings.Bytes("\n  ")),
+	CharData([]byte("\n  ")),
 	StartElement{Name{"", "hello"}, []Attr{Attr{Name{"", "lang"}, "en"}}},
-	CharData(strings.Bytes("World <>'\" 白鵬翔")),
+	CharData([]byte("World <>'\" 白鵬翔")),
 	EndElement{Name{"", "hello"}},
-	CharData(strings.Bytes("\n  ")),
+	CharData([]byte("\n  ")),
 	StartElement{Name{"", "goodbye"}, nil},
 	EndElement{Name{"", "goodbye"}},
-	CharData(strings.Bytes("\n  ")),
+	CharData([]byte("\n  ")),
 	StartElement{Name{"", "outer"}, []Attr{Attr{Name{"foo", "attr"}, "value"}, Attr{Name{"xmlns", "tag"}, "ns4"}}},
-	CharData(strings.Bytes("\n    ")),
+	CharData([]byte("\n    ")),
 	StartElement{Name{"", "inner"}, nil},
 	EndElement{Name{"", "inner"}},
-	CharData(strings.Bytes("\n  ")),
+	CharData([]byte("\n  ")),
 	EndElement{Name{"", "outer"}},
-	CharData(strings.Bytes("\n  ")),
+	CharData([]byte("\n  ")),
 	StartElement{Name{"tag", "name"}, nil},
-	CharData(strings.Bytes("\n    ")),
+	CharData([]byte("\n    ")),
-	CharData(strings.Bytes("Some text here.")),
+	CharData([]byte("Some text here.")),
-	CharData(strings.Bytes("\n  ")),
+	CharData([]byte("\n  ")),
 	EndElement{Name{"tag", "name"}},
-	CharData(strings.Bytes("\n")),
+	CharData([]byte("\n")),
 	EndElement{Name{"", "body"}},
-	Comment(strings.Bytes(" missing final newline ")),
+	Comment([]byte(" missing final newline ")),
 }
 
 var cookedTokens = []Token{
-	CharData(strings.Bytes("\n")),
+	CharData([]byte("\n")),
-	ProcInst{"xml", strings.Bytes(`version="1.0" encoding="UTF-8"`)},
+	ProcInst{"xml", []byte(`version="1.0" encoding="UTF-8"`)},
-	CharData(strings.Bytes("\n")),
+	CharData([]byte("\n")),
-	Directive(strings.Bytes(`DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
+	Directive([]byte(`DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
-  "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"`)),
+  "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"`),
-	CharData(strings.Bytes("\n")),
+	),
+	CharData([]byte("\n")),
 	StartElement{Name{"ns2", "body"}, []Attr{Attr{Name{"xmlns", "foo"}, "ns1"}, Attr{Name{"", "xmlns"}, "ns2"}, Attr{Name{"xmlns", "tag"}, "ns3"}}},
-	CharData(strings.Bytes("\n  ")),
+	CharData([]byte("\n  ")),
 	StartElement{Name{"ns2", "hello"}, []Attr{Attr{Name{"", "lang"}, "en"}}},
-	CharData(strings.Bytes("World <>'\" 白鵬翔")),
+	CharData([]byte("World <>'\" 白鵬翔")),
 	EndElement{Name{"ns2", "hello"}},
-	CharData(strings.Bytes("\n  ")),
+	CharData([]byte("\n  ")),
 	StartElement{Name{"ns2", "goodbye"}, nil},
 	EndElement{Name{"ns2", "goodbye"}},
-	CharData(strings.Bytes("\n  ")),
+	CharData([]byte("\n  ")),
 	StartElement{Name{"ns2", "outer"}, []Attr{Attr{Name{"ns1", "attr"}, "value"}, Attr{Name{"xmlns", "tag"}, "ns4"}}},
-	CharData(strings.Bytes("\n    ")),
+	CharData([]byte("\n    ")),
 	StartElement{Name{"ns2", "inner"}, nil},
 	EndElement{Name{"ns2", "inner"}},
-	CharData(strings.Bytes("\n  ")),
+	CharData([]byte("\n  ")),
 	EndElement{Name{"ns2", "outer"}},
-	CharData(strings.Bytes("\n  ")),
+	CharData([]byte("\n  ")),
 	StartElement{Name{"ns3", "name"}, nil},
-	CharData(strings.Bytes("\n    ")),
+	CharData([]byte("\n    ")),
-	CharData(strings.Bytes("Some text here.")),
+	CharData([]byte("Some text here.")),
-	CharData(strings.Bytes("\n  ")),
+	CharData([]byte("\n  ")),
 	EndElement{Name{"ns3", "name"}},
-	CharData(strings.Bytes("\n")),
+	CharData([]byte("\n")),
 	EndElement{Name{"ns2", "body"}},
-	Comment(strings.Bytes(" missing final newline ")),
+	Comment([]byte(" missing final newline ")),
 }
 
 var xmlInput = []string{

test/bench/chameneosredux.go

@@ -123,7 +123,7 @@ func pallmall(cols []int) {
 	fmt.Println(msg)
 	tot := 0
 	// wait for all results
-	for _ = range (cols) {
+	for _ = range cols {
 		result := <-ended
 		tot += result.met
 		fmt.Printf("%v%v\n", result.met, spell(result.same, true))

test/bench/fasta.go

@@ -41,7 +41,6 @@ import (
 	"bufio"
 	"flag"
 	"os"
-	"strings"
 )
 
 var out *bufio.Writer
@@ -161,7 +160,7 @@ func main() {
 	AccumulateProbabilities(iub)
 	AccumulateProbabilities(homosapiens)
 
-	alu := strings.Bytes(
+	alu := []byte(
 		"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
 			"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
 			"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +

test/bench/k-nucleotide.go

@@ -42,7 +42,6 @@ import (
 	"io/ioutil"
 	"os"
 	"sort"
-	"strings"
 )
 
 var in *bufio.Reader
@@ -111,7 +110,7 @@ func print(m map[string]int) {
 
 func main() {
 	in = bufio.NewReader(os.Stdin)
-	three := strings.Bytes(">THREE ")
+	three := []byte(">THREE ")
 	for {
 		line, err := in.ReadSlice('\n')
 		if err != nil {

test/bench/regex-dna.go

@@ -40,7 +40,6 @@ import (
 	"io/ioutil"
 	"os"
 	"regexp"
-	"strings"
 )
 
 var variants = []string{
@@ -101,7 +100,7 @@ func main() {
 		fmt.Printf("%s %d\n", s, countMatches(s, bytes))
 	}
 	for _, sub := range substs {
-		bytes = regexp.MustCompile(sub.pat).ReplaceAll(bytes, strings.Bytes(sub.repl))
+		bytes = regexp.MustCompile(sub.pat).ReplaceAll(bytes, []byte(sub.repl))
 	}
 	fmt.Printf("\n%d\n%d\n%d\n", ilen, clen, len(bytes))
 }