1
0
mirror of https://github.com/golang/go synced 2024-11-11 21:20:21 -07:00

strings: delete Runes, Bytes

gofmt -w -r 'strings.Bytes(a) -> []byte(a)' src/cmd src/pkg test/bench
gofmt -w -r 'strings.Runes(a) -> []int(a)' src/cmd src/pkg test/bench
delete unused imports

R=r
CC=golang-dev
https://golang.org/cl/224062
This commit is contained in:
Russ Cox 2010-02-25 16:01:29 -08:00
parent dfaa6eaa76
commit 9750adbbad
65 changed files with 239 additions and 310 deletions

View File

@ -724,7 +724,7 @@ func (c *typeConv) Opaque(n int64) ast.Expr {
func (c *typeConv) intExpr(n int64) ast.Expr {
return &ast.BasicLit{
Kind: token.INT,
Value: strings.Bytes(strconv.Itoa64(n)),
Value: []byte(strconv.Itoa64(n)),
}
}
@ -755,7 +755,7 @@ func (c *typeConv) Struct(dt *dwarf.StructType) (expr *ast.StructType, csyntax s
used[f.Name] = true
}
for cid, goid := range ident {
if token.Lookup(strings.Bytes(goid)).IsKeyword() {
if token.Lookup([]byte(goid)).IsKeyword() {
// Avoid keyword
goid = "_" + goid

View File

@ -13,7 +13,6 @@ import (
"io/ioutil"
"os"
"path"
"strings"
)
@ -29,8 +28,8 @@ func usage() {
// Markers around EBNF sections in .html files
var (
open = strings.Bytes(`<pre class="ebnf">`)
close = strings.Bytes(`</pre>`)
open = []byte(`<pre class="ebnf">`)
close = []byte(`</pre>`)
)

View File

@ -152,7 +152,7 @@ func pkgName(filename string) string {
func htmlEscape(s string) string {
var buf bytes.Buffer
template.HTMLEscape(&buf, strings.Bytes(s))
template.HTMLEscape(&buf, []byte(s))
return buf.String()
}
@ -476,7 +476,7 @@ func (s *Styler) BasicLit(x *ast.BasicLit) (text []byte, tag printer.HTMLTag) {
func (s *Styler) Ident(id *ast.Ident) (text []byte, tag printer.HTMLTag) {
text = strings.Bytes(id.Name())
text = []byte(id.Name())
if s.highlight == id.Name() {
tag = printer.HTMLTag{"<span class=highlight>", "</span>"}
}
@ -485,7 +485,7 @@ func (s *Styler) Ident(id *ast.Ident) (text []byte, tag printer.HTMLTag) {
func (s *Styler) Token(tok token.Token) (text []byte, tag printer.HTMLTag) {
text = strings.Bytes(tok.String())
text = []byte(tok.String())
return
}
@ -493,7 +493,7 @@ func (s *Styler) Token(tok token.Token) (text []byte, tag printer.HTMLTag) {
// ----------------------------------------------------------------------------
// Tab conversion
var spaces = strings.Bytes(" ") // 16 spaces seems like a good number
var spaces = []byte(" ") // 16 spaces seems like a good number
const (
indenting = iota
@ -595,7 +595,7 @@ func writeAny(w io.Writer, x interface{}, html bool) {
case []byte:
writeText(w, v, html)
case string:
writeText(w, strings.Bytes(v), html)
writeText(w, []byte(v), html)
case ast.Decl, ast.Expr, ast.Stmt, *ast.File:
writeNode(w, x, html, &defaultStyler)
default:
@ -674,13 +674,13 @@ func urlFmt(w io.Writer, x interface{}, format string) {
if strings.HasPrefix(relpath, "src/pkg/") {
relpath = relpath[len("src/pkg/"):]
}
template.HTMLEscape(w, strings.Bytes(pkgHandler.pattern+relpath))
template.HTMLEscape(w, []byte(pkgHandler.pattern+relpath))
case "url-src":
template.HTMLEscape(w, strings.Bytes("/"+relpath))
template.HTMLEscape(w, []byte("/"+relpath))
case "url-pos":
// line id's in html-printed source are of the
// form "L%d" where %d stands for the line number
template.HTMLEscape(w, strings.Bytes("/"+relpath))
template.HTMLEscape(w, []byte("/"+relpath))
fmt.Fprintf(w, "#L%d", line)
}
}
@ -742,7 +742,7 @@ func paddingFmt(w io.Writer, x interface{}, format string) {
// Template formatter for "time" format.
func timeFmt(w io.Writer, x interface{}, format string) {
// note: os.Dir.Mtime_ns is in uint64 in ns!
template.HTMLEscape(w, strings.Bytes(time.SecondsToLocalTime(int64(x.(uint64)/1e9)).String()))
template.HTMLEscape(w, []byte(time.SecondsToLocalTime(int64(x.(uint64)/1e9)).String()))
}
@ -757,7 +757,7 @@ func dirslashFmt(w io.Writer, x interface{}, format string) {
// Template formatter for "localname" format.
func localnameFmt(w io.Writer, x interface{}, format string) {
_, localname := pathutil.Split(x.(string))
template.HTMLEscape(w, strings.Bytes(localname))
template.HTMLEscape(w, []byte(localname))
}
@ -852,8 +852,8 @@ func serveText(c *http.Conn, text []byte) {
// Files
var (
tagBegin = strings.Bytes("<!--")
tagEnd = strings.Bytes("-->")
tagBegin = []byte("<!--")
tagEnd = []byte("-->")
)
// commentText returns the text of the first HTML comment in src.
@ -878,7 +878,7 @@ func serveHTMLDoc(c *http.Conn, r *http.Request, abspath, relpath string) {
// if it begins with "<!DOCTYPE " assume it is standalone
// html that doesn't need the template wrapping.
if bytes.HasPrefix(src, strings.Bytes("<!DOCTYPE ")) {
if bytes.HasPrefix(src, []byte("<!DOCTYPE ")) {
c.Write(src)
return
}

View File

@ -696,7 +696,7 @@ func (x *Index) LookupWord(w string) (match *LookupResult, alt *AltWords) {
func isIdentifier(s string) bool {
var S scanner.Scanner
S.Init("", strings.Bytes(s), nil, 0)
S.Init("", []byte(s), nil, 0)
if _, tok, _ := S.Scan(); tok == token.IDENT {
_, tok, _ := S.Scan()
return tok == token.EOF

View File

@ -14,7 +14,6 @@ import (
"go/ast"
"go/printer"
"fmt"
"strings"
)
@ -36,7 +35,7 @@ func (s *snippetStyler) LineTag(line int) (text []uint8, tag printer.HTMLTag) {
func (s *snippetStyler) Ident(id *ast.Ident) (text []byte, tag printer.HTMLTag) {
text = strings.Bytes(id.Name())
text = []byte(id.Name())
if s.highlight == id {
tag = printer.HTMLTag{"<span class=highlight>", "</span>"}
}

View File

@ -16,7 +16,6 @@ import (
"go/scanner"
"go/token"
"io"
"strings"
)
@ -166,8 +165,8 @@ func (p *ebnfParser) parse(out io.Writer, src []byte) {
// Markers around EBNF sections
var (
openTag = strings.Bytes(`<pre class="ebnf">`)
closeTag = strings.Bytes(`</pre>`)
openTag = []byte(`<pre class="ebnf">`)
closeTag = []byte(`</pre>`)
)

View File

@ -11,7 +11,6 @@ import (
"io"
"os"
"reflect"
"strings"
"testing"
)
@ -161,7 +160,7 @@ func TestPartialRead(t *testing.T) {
if _, err := io.ReadFull(tr, buf); err != nil {
t.Fatalf("Unexpected error: %v", err)
}
if expected := strings.Bytes("Kilt"); !bytes.Equal(buf, expected) {
if expected := []byte("Kilt"); !bytes.Equal(buf, expected) {
t.Errorf("Contents = %v, want %v", buf, expected)
}
@ -174,7 +173,7 @@ func TestPartialRead(t *testing.T) {
if _, err := io.ReadFull(tr, buf); err != nil {
t.Fatalf("Unexpected error: %v", err)
}
if expected := strings.Bytes("Google"); !bytes.Equal(buf, expected) {
if expected := []byte("Google"); !bytes.Equal(buf, expected) {
t.Errorf("Contents = %v, want %v", buf, expected)
}
}

View File

@ -11,7 +11,6 @@ import (
"io"
"os"
"strconv"
"strings"
)
var (
@ -72,7 +71,7 @@ func (tw *Writer) cString(b []byte, s string) {
}
return
}
for i, ch := range strings.Bytes(s) {
for i, ch := range []byte(s) {
b[i] = ch
}
if len(s) < len(b) {
@ -128,25 +127,25 @@ func (tw *Writer) WriteHeader(hdr *Header) os.Error {
s := slicer(header)
// TODO(dsymonds): handle names longer than 100 chars
copy(s.next(100), strings.Bytes(hdr.Name))
copy(s.next(100), []byte(hdr.Name))
tw.octal(s.next(8), hdr.Mode) // 100:108
tw.numeric(s.next(8), hdr.Uid) // 108:116
tw.numeric(s.next(8), hdr.Gid) // 116:124
tw.numeric(s.next(12), hdr.Size) // 124:136
tw.numeric(s.next(12), hdr.Mtime) // 136:148
s.next(8) // chksum (148:156)
s.next(1)[0] = hdr.Typeflag // 156:157
s.next(100) // linkname (157:257)
copy(s.next(8), strings.Bytes("ustar\x0000")) // 257:265
tw.cString(s.next(32), hdr.Uname) // 265:297
tw.cString(s.next(32), hdr.Gname) // 297:329
tw.numeric(s.next(8), hdr.Devmajor) // 329:337
tw.numeric(s.next(8), hdr.Devminor) // 337:345
tw.octal(s.next(8), hdr.Mode) // 100:108
tw.numeric(s.next(8), hdr.Uid) // 108:116
tw.numeric(s.next(8), hdr.Gid) // 116:124
tw.numeric(s.next(12), hdr.Size) // 124:136
tw.numeric(s.next(12), hdr.Mtime) // 136:148
s.next(8) // chksum (148:156)
s.next(1)[0] = hdr.Typeflag // 156:157
s.next(100) // linkname (157:257)
copy(s.next(8), []byte("ustar\x0000")) // 257:265
tw.cString(s.next(32), hdr.Uname) // 265:297
tw.cString(s.next(32), hdr.Gname) // 297:329
tw.numeric(s.next(8), hdr.Devmajor) // 329:337
tw.numeric(s.next(8), hdr.Devminor) // 337:345
// Use the GNU magic instead of POSIX magic if we used any GNU extensions.
if tw.usedBinary {
copy(header[257:265], strings.Bytes("ustar \x00"))
copy(header[257:265], []byte("ustar \x00"))
}
// The chksum field is terminated by a NUL and a space.

View File

@ -7,7 +7,6 @@ package asn1
import (
"bytes"
"reflect"
"strings"
"testing"
"time"
)
@ -165,7 +164,7 @@ var timeTestData = []timeTest{
func TestTime(t *testing.T) {
for i, test := range timeTestData {
ret, err := parseUTCTime(strings.Bytes(test.in))
ret, err := parseUTCTime([]byte(test.in))
if (err == nil) != test.ok {
t.Errorf("#%d: Incorrect error result (did fail? %v, expected: %v)", i, err == nil, test.ok)
}

View File

@ -10,7 +10,6 @@ import (
"io"
"os"
"reflect"
"strings"
"time"
)
@ -209,7 +208,7 @@ func marshalObjectIdentifier(out *forkableWriter, oid []int) (err os.Error) {
}
func marshalPrintableString(out *forkableWriter, s string) (err os.Error) {
b := strings.Bytes(s)
b := []byte(s)
for _, c := range b {
if !isPrintable(c) {
return StructuralError{"PrintableString contains invalid character"}
@ -221,7 +220,7 @@ func marshalPrintableString(out *forkableWriter, s string) (err os.Error) {
}
func marshalIA5String(out *forkableWriter, s string) (err os.Error) {
b := strings.Bytes(s)
b := []byte(s)
for _, c := range b {
if c > 127 {
return StructuralError{"IA5String contains invalid character"}

View File

@ -296,7 +296,7 @@ var errorWriterTests = []errorWriterTest{
func TestWriteErrors(t *testing.T) {
for _, w := range errorWriterTests {
buf := NewWriter(w)
_, e := buf.Write(strings.Bytes("hello world"))
_, e := buf.Write([]byte("hello world"))
if e != nil {
t.Errorf("Write hello to %v: %v", w, e)
continue

View File

@ -6,7 +6,6 @@ package bytes_test
import (
. "bytes"
"strings"
"testing"
"unicode"
)
@ -60,8 +59,8 @@ var comparetests = []BinOpTest{
func TestCompare(t *testing.T) {
for _, tt := range comparetests {
a := strings.Bytes(tt.a)
b := strings.Bytes(tt.b)
a := []byte(tt.a)
b := []byte(tt.b)
cmp := Compare(a, b)
eql := Equal(a, b)
if cmp != tt.i {
@ -94,8 +93,8 @@ var indextests = []BinOpTest{
func TestIndex(t *testing.T) {
for _, tt := range indextests {
a := strings.Bytes(tt.a)
b := strings.Bytes(tt.b)
a := []byte(tt.a)
b := []byte(tt.b)
pos := Index(a, b)
if pos != tt.i {
t.Errorf(`Index(%q, %q) = %v`, tt.a, tt.b, pos)
@ -108,7 +107,7 @@ func TestIndexByte(t *testing.T) {
if len(tt.b) != 1 {
continue
}
a := strings.Bytes(tt.a)
a := []byte(tt.a)
b := tt.b[0]
pos := IndexByte(a, b)
if pos != tt.i {
@ -171,7 +170,7 @@ var explodetests = []ExplodeTest{
func TestExplode(t *testing.T) {
for _, tt := range explodetests {
a := Split(strings.Bytes(tt.s), nil, tt.n)
a := Split([]byte(tt.s), nil, tt.n)
result := arrayOfString(a)
if !eq(result, tt.a) {
t.Errorf(`Explode("%s", %d) = %v; want %v`, tt.s, tt.n, result, tt.a)
@ -210,13 +209,13 @@ var splittests = []SplitTest{
func TestSplit(t *testing.T) {
for _, tt := range splittests {
a := Split(strings.Bytes(tt.s), strings.Bytes(tt.sep), tt.n)
a := Split([]byte(tt.s), []byte(tt.sep), tt.n)
result := arrayOfString(a)
if !eq(result, tt.a) {
t.Errorf(`Split(%q, %q, %d) = %v; want %v`, tt.s, tt.sep, tt.n, result, tt.a)
continue
}
s := Join(a, strings.Bytes(tt.sep))
s := Join(a, []byte(tt.sep))
if string(s) != tt.s {
t.Errorf(`Join(Split(%q, %q, %d), %q) = %q`, tt.s, tt.sep, tt.n, tt.sep, s)
}
@ -241,7 +240,7 @@ var splitaftertests = []SplitTest{
func TestSplitAfter(t *testing.T) {
for _, tt := range splitaftertests {
a := SplitAfter(strings.Bytes(tt.s), strings.Bytes(tt.sep), tt.n)
a := SplitAfter([]byte(tt.s), []byte(tt.sep), tt.n)
result := arrayOfString(a)
if !eq(result, tt.a) {
t.Errorf(`Split(%q, %q, %d) = %v; want %v`, tt.s, tt.sep, tt.n, result, tt.a)
@ -275,7 +274,7 @@ var fieldstests = []FieldsTest{
func TestFields(t *testing.T) {
for _, tt := range fieldstests {
a := Fields(strings.Bytes(tt.s))
a := Fields([]byte(tt.s))
result := arrayOfString(a)
if !eq(result, tt.a) {
t.Errorf("Fields(%q) = %v; want %v", tt.s, a, tt.a)
@ -434,7 +433,7 @@ func TestAdd(t *testing.T) {
for i := 0; i < len(test.s); i++ {
b[i] = test.s[i]
}
b = Add(b, strings.Bytes(test.t))
b = Add(b, []byte(test.t))
if string(b) != test.s+test.t {
t.Errorf("Add(%q,%q) = %q", test.s, test.t, string(b))
}
@ -474,8 +473,8 @@ var RepeatTests = []RepeatTest{
func TestRepeat(t *testing.T) {
for _, tt := range RepeatTests {
tin := strings.Bytes(tt.in)
tout := strings.Bytes(tt.out)
tin := []byte(tt.in)
tout := []byte(tt.out)
a := Repeat(tin, tt.count)
if !Equal(a, tout) {
t.Errorf("Repeat(%q, %d) = %q; want %q", tin, tt.count, a, tout)
@ -514,7 +513,7 @@ var RunesTests = []RunesTest{
func TestRunes(t *testing.T) {
for _, tt := range RunesTests {
tin := strings.Bytes(tt.in)
tin := []byte(tt.in)
a := Runes(tin)
if !runesEqual(a, tt.out) {
t.Errorf("Runes(%q) = %v; want %v", tin, a, tt.out)

View File

@ -7,7 +7,6 @@ package gzip
import (
"io"
"io/ioutil"
"strings"
"testing"
)
@ -53,10 +52,10 @@ func TestWriter(t *testing.T) {
pipe(t,
func(deflater *Deflater) {
deflater.Comment = "comment"
deflater.Extra = strings.Bytes("extra")
deflater.Extra = []byte("extra")
deflater.Mtime = 1e8
deflater.Name = "name"
_, err := deflater.Write(strings.Bytes("payload"))
_, err := deflater.Write([]byte("payload"))
if err != nil {
t.Fatalf("%v", err)
}

View File

@ -7,7 +7,6 @@ package hmac
import (
"hash"
"fmt"
"strings"
"testing"
)
@ -33,7 +32,7 @@ var hmacTests = []hmacTest{
0x30, 0x31, 0x32, 0x33, 0x34, 0x35, 0x36, 0x37,
0x38, 0x39, 0x3a, 0x3b, 0x3c, 0x3d, 0x3e, 0x3f,
},
strings.Bytes("Sample #1"),
[]byte("Sample #1"),
"4f4ca3d5d68ba7cc0a1208c9c61e9c5da0403c0a",
},
hmacTest{
@ -43,7 +42,7 @@ var hmacTests = []hmacTest{
0x38, 0x39, 0x3a, 0x3b, 0x3c, 0x3d, 0x3e, 0x3f,
0x40, 0x41, 0x42, 0x43,
},
strings.Bytes("Sample #2"),
[]byte("Sample #2"),
"0922d3405faa3d194f82a45830737d5cc6c75d24",
},
hmacTest{
@ -63,15 +62,15 @@ var hmacTests = []hmacTest{
0xa8, 0xa9, 0xaa, 0xab, 0xac, 0xad, 0xae, 0xaf,
0xb0, 0xb1, 0xb2, 0xb3,
},
strings.Bytes("Sample #3"),
[]byte("Sample #3"),
"bcf41eab8bb2d802f3d05caf7cb092ecf8d1a3aa",
},
// Test from Plan 9.
hmacTest{
NewMD5,
strings.Bytes("Jefe"),
strings.Bytes("what do ya want for nothing?"),
[]byte("Jefe"),
[]byte("what do ya want for nothing?"),
"750c783e6ab0b503eaa86e310a5db738",
},
}

View File

@ -12,14 +12,13 @@ import (
"encoding/hex"
"os"
"io"
"strings"
"testing"
"testing/quick"
)
func decodeBase64(in string) []byte {
out := make([]byte, base64.StdEncoding.DecodedLen(len(in)))
n, err := base64.StdEncoding.Decode(out, strings.Bytes(in))
n, err := base64.StdEncoding.Decode(out, []byte(in))
if err != nil {
return nil
}
@ -56,7 +55,7 @@ func TestDecryptPKCS1v15(t *testing.T) {
if err != nil {
t.Errorf("#%d error decrypting", i)
}
want := strings.Bytes(test.out)
want := []byte(test.out)
if bytes.Compare(out, want) != 0 {
t.Errorf("#%d got:%#v want:%#v", i, out, want)
}
@ -125,12 +124,12 @@ var decryptPKCS1v15SessionKeyTests = []DecryptPKCS1v15Test{
func TestEncryptPKCS1v15SessionKey(t *testing.T) {
for i, test := range decryptPKCS1v15SessionKeyTests {
key := strings.Bytes("FAIL")
key := []byte("FAIL")
err := DecryptPKCS1v15SessionKey(nil, rsaPrivateKey, decodeBase64(test.in), key)
if err != nil {
t.Errorf("#%d error decrypting", i)
}
want := strings.Bytes(test.out)
want := []byte(test.out)
if bytes.Compare(key, want) != 0 {
t.Errorf("#%d got:%#v want:%#v", i, key, want)
}
@ -169,7 +168,7 @@ var signPKCS1v15Tests = []signPKCS1v15Test{
func TestSignPKCS1v15(t *testing.T) {
for i, test := range signPKCS1v15Tests {
h := sha1.New()
h.Write(strings.Bytes(test.in))
h.Write([]byte(test.in))
digest := h.Sum()
s, err := SignPKCS1v15(nil, rsaPrivateKey, HashSHA1, digest)
@ -187,7 +186,7 @@ func TestSignPKCS1v15(t *testing.T) {
func TestVerifyPKCS1v15(t *testing.T) {
for i, test := range signPKCS1v15Tests {
h := sha1.New()
h.Write(strings.Bytes(test.in))
h.Write([]byte(test.in))
digest := h.Sum()
sig, _ := hex.DecodeString(test.out)

View File

@ -4,8 +4,6 @@
package tls
import "strings"
type clientHelloMsg struct {
raw []byte
major, minor uint8
@ -100,7 +98,7 @@ func (m *clientHelloMsg) marshal() []byte {
z[1] = 1
z[3] = byte(len(m.serverName) >> 8)
z[4] = byte(len(m.serverName))
copy(z[5:], strings.Bytes(m.serverName))
copy(z[5:], []byte(m.serverName))
z = z[l:]
}
@ -280,7 +278,7 @@ func (m *serverHelloMsg) marshal() []byte {
l = 255
}
z[0] = byte(l)
copy(z[1:], strings.Bytes(v[0:l]))
copy(z[1:], []byte(v[0:l]))
z = z[1+l:]
}
}
@ -548,7 +546,7 @@ func (m *nextProtoMsg) marshal() []byte {
y := x[4:]
y[0] = byte(l)
copy(y[1:], strings.Bytes(m.proto[0:l]))
copy(y[1:], []byte(m.proto[0:l]))
y = y[1+l:]
y[0] = byte(padding)

View File

@ -10,7 +10,6 @@ import (
"crypto/sha1"
"hash"
"os"
"strings"
)
// Split a premaster secret in two as specified in RFC 4346, section 5.
@ -70,10 +69,10 @@ const (
finishedVerifyLength = 12 // Length of verify_data in a Finished message.
)
var masterSecretLabel = strings.Bytes("master secret")
var keyExpansionLabel = strings.Bytes("key expansion")
var clientFinishedLabel = strings.Bytes("client finished")
var serverFinishedLabel = strings.Bytes("server finished")
var masterSecretLabel = []byte("master secret")
var keyExpansionLabel = []byte("key expansion")
var clientFinishedLabel = []byte("client finished")
var serverFinishedLabel = []byte("server finished")
// keysFromPreMasterSecret generates the connection keys from the pre master
// secret, given the lengths of the MAC and cipher keys, as defined in RFC

View File

@ -735,7 +735,7 @@ func buildExtensions(template *Certificate) (ret []extension, err os.Error) {
ret[n].Id = oidExtensionSubjectAltName
rawValues := make([]asn1.RawValue, len(template.DNSNames))
for i, name := range template.DNSNames {
rawValues[i] = asn1.RawValue{Tag: 2, Class: 2, Bytes: strings.Bytes(name)}
rawValues[i] = asn1.RawValue{Tag: 2, Class: 2, Bytes: []byte(name)}
}
ret[n].Value, err = asn1.MarshalToMemory(rawValues)
if err != nil {

View File

@ -11,13 +11,12 @@ import (
"encoding/pem"
"os"
"reflect"
"strings"
"testing"
"time"
)
func TestParsePKCS1PrivateKey(t *testing.T) {
block, _ := pem.Decode(strings.Bytes(pemPrivateKey))
block, _ := pem.Decode([]byte(pemPrivateKey))
priv, err := ParsePKCS1PrivateKey(block.Bytes)
if err != nil {
t.Errorf("Failed to parse private key: %s", err)
@ -151,7 +150,7 @@ func TestCreateSelfSignedCertificate(t *testing.T) {
t.Errorf("failed to open /dev/urandom")
}
block, _ := pem.Decode(strings.Bytes(pemPrivateKey))
block, _ := pem.Decode([]byte(pemPrivateKey))
priv, err := ParsePKCS1PrivateKey(block.Bytes)
if err != nil {
t.Errorf("Failed to parse private key: %s", err)

View File

@ -6,7 +6,6 @@ package ebnf
import (
"io/ioutil"
"strings"
"testing"
)
@ -53,7 +52,7 @@ func check(t *testing.T, filename string, src []byte) {
func TestGrammars(t *testing.T) {
for _, src := range grammars {
check(t, "", strings.Bytes(src))
check(t, "", []byte(src))
}
}

View File

@ -8,7 +8,6 @@ import (
"bytes"
"io/ioutil"
"os"
"strings"
"testing"
)
@ -57,7 +56,7 @@ func strip85(s string) string {
func TestEncode(t *testing.T) {
for _, p := range pairs {
buf := make([]byte, MaxEncodedLen(len(p.decoded)))
n := Encode(buf, strings.Bytes(p.decoded))
n := Encode(buf, []byte(p.decoded))
buf = buf[0:n]
testEqual(t, "Encode(%q) = %q, want %q", p.decoded, strip85(string(buf)), strip85(p.encoded))
}
@ -67,14 +66,14 @@ func TestEncoder(t *testing.T) {
for _, p := range pairs {
bb := &bytes.Buffer{}
encoder := NewEncoder(bb)
encoder.Write(strings.Bytes(p.decoded))
encoder.Write([]byte(p.decoded))
encoder.Close()
testEqual(t, "Encode(%q) = %q, want %q", p.decoded, strip85(bb.String()), strip85(p.encoded))
}
}
func TestEncoderBuffering(t *testing.T) {
input := strings.Bytes(bigtest.decoded)
input := []byte(bigtest.decoded)
for bs := 1; bs <= 12; bs++ {
bb := &bytes.Buffer{}
encoder := NewEncoder(bb)
@ -96,7 +95,7 @@ func TestEncoderBuffering(t *testing.T) {
func TestDecode(t *testing.T) {
for _, p := range pairs {
dbuf := make([]byte, 4*len(p.encoded))
ndst, nsrc, err := Decode(dbuf, strings.Bytes(p.encoded), true)
ndst, nsrc, err := Decode(dbuf, []byte(p.encoded), true)
testEqual(t, "Decode(%q) = error %v, want %v", p.encoded, err, os.Error(nil))
testEqual(t, "Decode(%q) = nsrc %v, want %v", p.encoded, nsrc, len(p.encoded))
testEqual(t, "Decode(%q) = ndst %v, want %v", p.encoded, ndst, len(p.decoded))
@ -145,7 +144,7 @@ func TestDecodeCorrupt(t *testing.T) {
for _, e := range examples {
dbuf := make([]byte, 4*len(e.e))
_, _, err := Decode(dbuf, strings.Bytes(e.e), true)
_, _, err := Decode(dbuf, []byte(e.e), true)
switch err := err.(type) {
case CorruptInputError:
testEqual(t, "Corruption in %q at offset %v, want %v", e.e, int(err), e.p)

View File

@ -8,7 +8,6 @@ import (
"bytes"
"io/ioutil"
"os"
"strings"
"testing"
)
@ -58,7 +57,7 @@ func testEqual(t *testing.T, msg string, args ...interface{}) bool {
func TestEncode(t *testing.T) {
for _, p := range pairs {
buf := make([]byte, StdEncoding.EncodedLen(len(p.decoded)))
StdEncoding.Encode(buf, strings.Bytes(p.decoded))
StdEncoding.Encode(buf, []byte(p.decoded))
testEqual(t, "Encode(%q) = %q, want %q", p.decoded, string(buf), p.encoded)
}
}
@ -67,14 +66,14 @@ func TestEncoder(t *testing.T) {
for _, p := range pairs {
bb := &bytes.Buffer{}
encoder := NewEncoder(StdEncoding, bb)
encoder.Write(strings.Bytes(p.decoded))
encoder.Write([]byte(p.decoded))
encoder.Close()
testEqual(t, "Encode(%q) = %q, want %q", p.decoded, bb.String(), p.encoded)
}
}
func TestEncoderBuffering(t *testing.T) {
input := strings.Bytes(bigtest.decoded)
input := []byte(bigtest.decoded)
for bs := 1; bs <= 12; bs++ {
bb := &bytes.Buffer{}
encoder := NewEncoder(StdEncoding, bb)
@ -96,7 +95,7 @@ func TestEncoderBuffering(t *testing.T) {
func TestDecode(t *testing.T) {
for _, p := range pairs {
dbuf := make([]byte, StdEncoding.DecodedLen(len(p.encoded)))
count, end, err := StdEncoding.decode(dbuf, strings.Bytes(p.encoded))
count, end, err := StdEncoding.decode(dbuf, []byte(p.encoded))
testEqual(t, "Decode(%q) = error %v, want %v", p.encoded, err, os.Error(nil))
testEqual(t, "Decode(%q) = length %v, want %v", p.encoded, count, len(p.decoded))
if len(p.encoded) > 0 {
@ -153,7 +152,7 @@ func TestDecodeCorrupt(t *testing.T) {
for _, e := range examples {
dbuf := make([]byte, StdEncoding.DecodedLen(len(e.e)))
_, err := StdEncoding.Decode(dbuf, strings.Bytes(e.e))
_, err := StdEncoding.Decode(dbuf, []byte(e.e))
switch err := err.(type) {
case CorruptInputError:
testEqual(t, "Corruption in %q at offset %v, want %v", e.e, int(err), e.p)

View File

@ -8,7 +8,6 @@ import (
"bytes"
"io/ioutil"
"os"
"strings"
"testing"
)
@ -61,7 +60,7 @@ var gitBigtest = gitPairs[len(gitPairs)-1]
func TestEncode(t *testing.T) {
for _, p := range gitPairs {
buf := make([]byte, EncodedLen(len(p.decoded)))
n := Encode(buf, strings.Bytes(p.decoded))
n := Encode(buf, []byte(p.decoded))
if n != len(buf) {
t.Errorf("EncodedLen does not agree with Encode")
}
@ -74,14 +73,14 @@ func TestEncoder(t *testing.T) {
for _, p := range gitPairs {
bb := &bytes.Buffer{}
encoder := NewEncoder(bb)
encoder.Write(strings.Bytes(p.decoded))
encoder.Write([]byte(p.decoded))
encoder.Close()
testEqual(t, "Encode(%q) = %q, want %q", p.decoded, bb.String(), p.encoded)
}
}
func TestEncoderBuffering(t *testing.T) {
input := strings.Bytes(gitBigtest.decoded)
input := []byte(gitBigtest.decoded)
for bs := 1; bs <= 12; bs++ {
bb := &bytes.Buffer{}
encoder := NewEncoder(bb)
@ -103,7 +102,7 @@ func TestEncoderBuffering(t *testing.T) {
func TestDecode(t *testing.T) {
for _, p := range gitPairs {
dbuf := make([]byte, 4*len(p.encoded))
ndst, err := Decode(dbuf, strings.Bytes(p.encoded))
ndst, err := Decode(dbuf, []byte(p.encoded))
testEqual(t, "Decode(%q) = error %v, want %v", p.encoded, err, os.Error(nil))
testEqual(t, "Decode(%q) = ndst %v, want %v", p.encoded, ndst, len(p.decoded))
testEqual(t, "Decode(%q) = %q, want %q", p.encoded, string(dbuf[0:ndst]), p.decoded)
@ -151,7 +150,7 @@ func TestDecodeCorrupt(t *testing.T) {
for _, e := range examples {
dbuf := make([]byte, 2*len(e.e))
_, err := Decode(dbuf, strings.Bytes(e.e))
_, err := Decode(dbuf, []byte(e.e))
switch err := err.(type) {
case CorruptInputError:
testEqual(t, "Corruption in %q at offset %v, want %v", e.e, int(err), e.p)

View File

@ -8,7 +8,6 @@ package hex
import (
"os"
"strconv"
"strings"
)
const hextable = "0123456789abcdef"
@ -92,7 +91,7 @@ func EncodeToString(src []byte) string {
// DecodeString returns the bytes represented by the hexadecimal string s.
func DecodeString(s string) ([]byte, os.Error) {
src := strings.Bytes(s)
src := []byte(s)
dst := make([]byte, DecodedLen(len(src)))
_, err := Decode(dst, src)
if err != nil {

View File

@ -12,7 +12,6 @@ import (
"encoding/base64"
"io"
"os"
"strings"
)
// A Block represents a PEM encoded structure.
@ -65,9 +64,9 @@ func removeWhitespace(data []byte) []byte {
return result[0:n]
}
var pemStart = strings.Bytes("\n-----BEGIN ")
var pemEnd = strings.Bytes("\n-----END ")
var pemEndOfLine = strings.Bytes("-----")
var pemStart = []byte("\n-----BEGIN ")
var pemEnd = []byte("\n-----END ")
var pemEndOfLine = []byte("-----")
// Decode will find the next PEM formatted block (certificate, private key
// etc) in the input. It returns that block and the remainder of the input. If
@ -214,13 +213,13 @@ func Encode(out io.Writer, b *Block) (err os.Error) {
if err != nil {
return
}
_, err = out.Write(strings.Bytes(b.Type + "-----\n"))
_, err = out.Write([]byte(b.Type + "-----\n"))
if err != nil {
return
}
for k, v := range b.Headers {
_, err = out.Write(strings.Bytes(k + ": " + v + "\n"))
_, err = out.Write([]byte(k + ": " + v + "\n"))
if err != nil {
return
}
@ -248,7 +247,7 @@ func Encode(out io.Writer, b *Block) (err os.Error) {
if err != nil {
return
}
_, err = out.Write(strings.Bytes(b.Type + "-----\n"))
_, err = out.Write([]byte(b.Type + "-----\n"))
return
}

View File

@ -7,7 +7,6 @@ package pem
import (
"bytes"
"reflect"
"strings"
"testing"
)
@ -28,7 +27,7 @@ var getLineTests = []GetLineTest{
func TestGetLine(t *testing.T) {
for i, test := range getLineTests {
x, y := getLine(strings.Bytes(test.in))
x, y := getLine([]byte(test.in))
if string(x) != test.out1 || string(y) != test.out2 {
t.Errorf("#%d got:%+v,%+v want:%s,%s", i, x, y, test.out1, test.out2)
}
@ -36,7 +35,7 @@ func TestGetLine(t *testing.T) {
}
func TestDecode(t *testing.T) {
result, remainder := Decode(strings.Bytes(pemData))
result, remainder := Decode([]byte(pemData))
if !reflect.DeepEqual(result, certificate) {
t.Errorf("#0 got:%#v want:%#v", result, certificate)
}
@ -44,7 +43,7 @@ func TestDecode(t *testing.T) {
if !reflect.DeepEqual(result, privateKey) {
t.Errorf("#1 got:%#v want:%#v", result, privateKey)
}
result, _ = Decode(strings.Bytes(pemPrivateKey))
result, _ = Decode([]byte(pemPrivateKey))
if !reflect.DeepEqual(result, privateKey2) {
t.Errorf("#2 got:%#v want:%#v", result, privateKey2)
}
@ -77,7 +76,7 @@ func TestLineBreaker(t *testing.T) {
buf := bytes.NewBuffer(nil)
var breaker lineBreaker
breaker.out = buf
_, err := breaker.Write(strings.Bytes(test.in))
_, err := breaker.Write([]byte(test.in))
if err != nil {
t.Errorf("#%d: error from Write: %s", i, err)
continue
@ -99,7 +98,7 @@ func TestLineBreaker(t *testing.T) {
breaker.out = buf
for i := 0; i < len(test.in); i++ {
_, err := breaker.Write(strings.Bytes(test.in[i : i+1]))
_, err := breaker.Write([]byte(test.in[i : i+1]))
if err != nil {
t.Errorf("#%d: error from Write (byte by byte): %s", i, err)
continue

View File

@ -6,13 +6,12 @@ package datafmt
import (
"fmt"
"strings"
"testing"
)
func parse(t *testing.T, form string, fmap FormatterMap) Format {
f, err := Parse("", strings.Bytes(form), fmap)
f, err := Parse("", []byte(form), fmap)
if err != nil {
t.Errorf("Parse(%s): %v", form, err)
return nil
@ -52,7 +51,7 @@ func formatter(s *State, value interface{}, rule_name string) bool {
case "nil":
return false
case "testing.T":
s.Write(strings.Bytes("testing.T"))
s.Write([]byte("testing.T"))
return true
}
panic("unreachable")

View File

@ -137,7 +137,7 @@ func (p *parser) parseString() string {
func (p *parser) parseLiteral() literal {
s := strings.Bytes(p.parseString())
s := []byte(p.parseString())
// A string literal may contain %-format specifiers. To simplify
// and speed up printing of the literal, split it into segments

View File

@ -32,7 +32,6 @@ import (
"log"
"os"
"runtime"
"strings"
"time"
"./pdp1"
)
@ -53,7 +52,7 @@ func main() {
var m SpacewarPDP1
m.Init(w)
m.PC = 4
f := bytes.NewBuffer(strings.Bytes(spacewarCode))
f := bytes.NewBuffer([]byte(spacewarCode))
if err = m.Load(f); err != nil {
log.Exitf("loading %s: %s", "spacewar.lst", err)
}

View File

@ -66,12 +66,12 @@ var fmttests = []fmtTest{
fmtTest{"%q", "abc", `"abc"`},
// basic bytes
fmtTest{"%s", strings.Bytes("abc"), "abc"},
fmtTest{"%x", strings.Bytes("abc"), "616263"},
fmtTest{"% x", strings.Bytes("abc"), "61 62 63"},
fmtTest{"%x", strings.Bytes("xyz"), "78797a"},
fmtTest{"%X", strings.Bytes("xyz"), "78797A"},
fmtTest{"%q", strings.Bytes("abc"), `"abc"`},
fmtTest{"%s", []byte("abc"), "abc"},
fmtTest{"%x", []byte("abc"), "616263"},
fmtTest{"% x", []byte("abc"), "61 62 63"},
fmtTest{"%x", []byte("xyz"), "78797a"},
fmtTest{"%X", []byte("xyz"), "78797A"},
fmtTest{"%q", []byte("abc"), `"abc"`},
// escaped strings
fmtTest{"%#q", `abc`, "`abc`"},

View File

@ -123,8 +123,8 @@ func split(text []byte) [][]byte {
var (
ldquo = strings.Bytes("&ldquo;")
rdquo = strings.Bytes("&rdquo;")
ldquo = []byte("&ldquo;")
rdquo = []byte("&rdquo;")
)
// Escape comment text for HTML.
@ -149,10 +149,10 @@ func commentEscape(w io.Writer, s []byte) {
var (
html_p = strings.Bytes("<p>\n")
html_endp = strings.Bytes("</p>\n")
html_pre = strings.Bytes("<pre>")
html_endpre = strings.Bytes("</pre>\n")
html_p = []byte("<p>\n")
html_endp = []byte("</p>\n")
html_pre = []byte("<pre>")
html_endpre = []byte("</pre>\n")
)

View File

@ -15,7 +15,6 @@ import (
"io/ioutil"
"os"
pathutil "path"
"strings"
)
@ -27,7 +26,7 @@ func readSource(filename string, src interface{}) ([]byte, os.Error) {
if src != nil {
switch s := src.(type) {
case string:
return strings.Bytes(s), nil
return []byte(s), nil
case []byte:
return s, nil
case *bytes.Buffer:

View File

@ -12,7 +12,6 @@ import (
"bytes"
"go/ast"
"go/token"
"strings"
)
@ -286,7 +285,7 @@ func (p *printer) isOneLineFieldList(list []*ast.Field) bool {
func (p *printer) setLineComment(text string) {
p.setComment(&ast.CommentGroup{[]*ast.Comment{&ast.Comment{noPos, strings.Bytes(text)}}})
p.setComment(&ast.CommentGroup{[]*ast.Comment{&ast.Comment{noPos, []byte(text)}}})
}

View File

@ -14,7 +14,6 @@ import (
"os"
"reflect"
"runtime"
"strings"
"tabwriter"
)
@ -45,11 +44,11 @@ var (
newlines = [...]byte{'\n', '\n', '\n', '\n', '\n', '\n', '\n', '\n'} // more than maxNewlines
formfeeds = [...]byte{'\f', '\f', '\f', '\f', '\f', '\f', '\f', '\f'} // more than maxNewlines
esc_quot = strings.Bytes("&#34;") // shorter than "&quot;"
esc_apos = strings.Bytes("&#39;") // shorter than "&apos;"
esc_amp = strings.Bytes("&amp;")
esc_lt = strings.Bytes("&lt;")
esc_gt = strings.Bytes("&gt;")
esc_quot = []byte("&#34;") // shorter than "&quot;"
esc_apos = []byte("&#39;") // shorter than "&apos;"
esc_amp = []byte("&amp;")
esc_lt = []byte("&lt;")
esc_gt = []byte("&gt;")
)
@ -223,12 +222,12 @@ func (p *printer) writeTaggedItem(data []byte, tag HTMLTag) {
// write start tag, if any
// (no html-escaping and no p.pos update for tags - use write0)
if tag.Start != "" {
p.write0(strings.Bytes(tag.Start))
p.write0([]byte(tag.Start))
}
p.write(data)
// write end tag, if any
if tag.End != "" {
p.write0(strings.Bytes(tag.End))
p.write0([]byte(tag.End))
}
}
@ -247,7 +246,7 @@ func (p *printer) writeItem(pos token.Position, data []byte, tag HTMLTag) {
}
if debug {
// do not update p.pos - use write0
p.write0(strings.Bytes(fmt.Sprintf("[%d:%d]", pos.Line, pos.Column)))
p.write0([]byte(fmt.Sprintf("[%d:%d]", pos.Line, pos.Column)))
}
if p.Mode&GenHTML != 0 {
// write line tag if on a new line
@ -744,7 +743,7 @@ func (p *printer) print(args ...) {
if p.Styler != nil {
data, tag = p.Styler.Ident(x)
} else {
data = strings.Bytes(x.Name())
data = []byte(x.Name())
}
case *ast.BasicLit:
if p.Styler != nil {
@ -756,12 +755,12 @@ func (p *printer) print(args ...) {
// (note that valid Go programs cannot contain esc ('\xff')
// bytes since they do not appear in legal UTF-8 sequences)
// TODO(gri): do this more efficiently.
data = strings.Bytes("\xff" + string(data) + "\xff")
data = []byte("\xff" + string(data) + "\xff")
case token.Token:
if p.Styler != nil {
data, tag = p.Styler.Token(x)
} else {
data = strings.Bytes(x.String())
data = []byte(x.String())
}
isKeyword = x.IsKeyword()
case token.Position:

View File

@ -7,7 +7,6 @@ package scanner
import (
"go/token"
"os"
"strings"
"testing"
)
@ -225,7 +224,7 @@ func TestScan(t *testing.T) {
// verify scan
index := 0
epos := token.Position{"", 0, 1, 1}
nerrors := Tokenize("", strings.Bytes(src), &testErrorHandler{t}, ScanComments,
nerrors := Tokenize("", []byte(src), &testErrorHandler{t}, ScanComments,
func(pos token.Position, tok token.Token, litb []byte) bool {
e := elt{token.EOF, "", special}
if index < len(tokens) {
@ -264,7 +263,7 @@ func TestScan(t *testing.T) {
func checkSemi(t *testing.T, line string, mode uint) {
var S Scanner
S.Init("TestSemis", strings.Bytes(line), nil, mode)
S.Init("TestSemis", []byte(line), nil, mode)
pos, tok, lit := S.Scan()
for tok != token.EOF {
if tok == token.ILLEGAL {
@ -451,7 +450,7 @@ func TestLineComments(t *testing.T) {
// verify scan
var S Scanner
S.Init("TestLineComments", strings.Bytes(src), nil, 0)
S.Init("TestLineComments", []byte(src), nil, 0)
for _, s := range segments {
pos, _, lit := S.Scan()
checkPos(t, string(lit), pos, token.Position{s.filename, pos.Offset, s.line, pos.Column})
@ -468,7 +467,7 @@ func TestInit(t *testing.T) {
var s Scanner
// 1st init
s.Init("", strings.Bytes("if true { }"), nil, 0)
s.Init("", []byte("if true { }"), nil, 0)
s.Scan() // if
s.Scan() // true
_, tok, _ := s.Scan() // {
@ -477,7 +476,7 @@ func TestInit(t *testing.T) {
}
// 2nd init
s.Init("", strings.Bytes("go true { ]"), nil, 0)
s.Init("", []byte("go true { ]"), nil, 0)
_, tok, _ = s.Scan() // go
if tok != token.GO {
t.Errorf("bad token: got %s, expected %s", tok.String(), token.GO)
@ -493,7 +492,7 @@ func TestIllegalChars(t *testing.T) {
var s Scanner
const src = "*?*$*@*"
s.Init("", strings.Bytes(src), &testErrorHandler{t}, AllowIllegalChars)
s.Init("", []byte(src), &testErrorHandler{t}, AllowIllegalChars)
for offs, ch := range src {
pos, tok, lit := s.Scan()
if pos.Offset != offs {
@ -521,7 +520,7 @@ func TestStdErrorHander(t *testing.T) {
"@ @ @" // original file, line 1 again
v := new(ErrorVector)
nerrors := Tokenize("File1", strings.Bytes(src), v, 0,
nerrors := Tokenize("File1", []byte(src), v, 0,
func(pos token.Position, tok token.Token, litb []byte) bool {
return tok != token.EOF
})
@ -567,7 +566,7 @@ func (h *errorCollector) Error(pos token.Position, msg string) {
func checkError(t *testing.T, src string, tok token.Token, pos int, err string) {
var s Scanner
var h errorCollector
s.Init("", strings.Bytes(src), &h, ScanComments)
s.Init("", []byte(src), &h, ScanComments)
_, tok0, _ := s.Scan()
_, tok1, _ := s.Scan()
if tok0 != tok {

View File

@ -298,7 +298,7 @@ func TestScalarEncInstructions(t *testing.T) {
// bytes == []uint8
{
b.Reset()
data := struct{ a []byte }{strings.Bytes("hello")}
data := struct{ a []byte }{[]byte("hello")}
instr := &encInstr{encUint8Array, 6, 0, 0}
state := newencoderState(b)
instr.op(instr, state, unsafe.Pointer(&data))
@ -587,7 +587,7 @@ func TestEndToEnd(t *testing.T) {
strs: &[2]string{s1, s2},
int64s: &[]int64{77, 89, 123412342134},
s: "Now is the time",
y: strings.Bytes("hello, sailor"),
y: []byte("hello, sailor"),
t: &T2{"this is T2"},
}
b := new(bytes.Buffer)
@ -935,7 +935,7 @@ func TestIgnoredFields(t *testing.T) {
it0.ignore_e[2] = 3.0
it0.ignore_f = true
it0.ignore_g = "pay no attention"
it0.ignore_h = strings.Bytes("to the curtain")
it0.ignore_h = []byte("to the curtain")
it0.ignore_i = &RT1{3.1, "hi", 7, "hello"}
b := new(bytes.Buffer)

View File

@ -46,7 +46,7 @@ func send(req *Request) (resp *Response, err os.Error) {
if len(info) > 0 {
enc := base64.URLEncoding
encoded := make([]byte, enc.EncodedLen(len(info)))
enc.Encode(encoded, strings.Bytes(info))
enc.Encode(encoded, []byte(info))
if req.Header == nil {
req.Header = make(map[string]string)
}

View File

@ -4,10 +4,6 @@
package http
import (
"strings"
)
// This file deals with lexical matters of HTTP
func isSeparator(c byte) bool {
@ -112,7 +108,7 @@ func httpUnquote(raw []byte) (eaten int, result string) {
// the input string might be parsed. result is always non-nil.
func httpSplitFieldValue(fv string) (eaten int, result []string) {
result = make([]string, 0, len(fv))
raw := strings.Bytes(fv)
raw := []byte(fv)
i := 0
chunk := ""
for i < len(raw) {

View File

@ -376,7 +376,7 @@ func CanonicalHeaderKey(s string) string {
// and upper case after each dash.
// (Host, User-Agent, If-Modified-Since).
// HTTP headers are ASCII only, so no Unicode issues.
a := strings.Bytes(s)
a := []byte(s)
upper := true
for i, v := range a {
if upper && 'a' <= v && v <= 'z' {

View File

@ -70,7 +70,7 @@ func shouldEscape(c byte) bool {
// CanonicalPath applies the algorithm specified in RFC 2396 to
// simplify the path, removing unnecessary . and .. elements.
func CanonicalPath(path string) string {
buf := strings.Bytes(path)
buf := []byte(path)
a := buf[0:0]
// state helps to find /.. ^.. ^. and /. patterns.
// state == 1 - prev char is '/' or beginning of the string.

View File

@ -8,10 +8,7 @@
// abstract the functionality, plus some other related primitives.
package io
import (
"os"
"strings"
)
import "os"
// Error represents an unexpected I/O behavior.
type Error struct {
@ -160,7 +157,7 @@ type ReadByter interface {
// WriteString writes the contents of the string s to w, which accepts an array of bytes.
func WriteString(w Writer, s string) (n int, err os.Error) {
return w.Write(strings.Bytes(s))
return w.Write([]byte(s))
}
// ReadAtLeast reads from r into buf until it has read at least min bytes.

View File

@ -7,7 +7,6 @@ package ioutil_test
import (
. "io/ioutil"
"os"
"strings"
"testing"
)
@ -43,7 +42,7 @@ func TestWriteFile(t *testing.T) {
"build bigger and better idiot-proof programs, and the Universe trying " +
"to produce bigger and better idiots. So far, the Universe is winning."
if err := WriteFile(filename, strings.Bytes(data), 0644); err != nil {
if err := WriteFile(filename, []byte(data), 0644); err != nil {
t.Fatalf("WriteFile %s: %v", filename, err)
}

View File

@ -8,7 +8,6 @@ import (
"fmt"
. "io"
"os"
"strings"
"testing"
"time"
)
@ -29,7 +28,7 @@ func TestPipe1(t *testing.T) {
c := make(chan int)
r, w := Pipe()
var buf = make([]byte, 64)
go checkWrite(t, w, strings.Bytes("hello, world"), c)
go checkWrite(t, w, []byte("hello, world"), c)
n, err := r.Read(buf)
if err != nil {
t.Errorf("read: %v", err)

View File

@ -7,7 +7,6 @@ package net
import (
"flag"
"io"
"strings"
"syscall"
"testing"
)
@ -18,7 +17,7 @@ var ipv6 = flag.Bool("ipv6", false, "assume ipv6 tunnel is present")
// fd is already connected to the destination, port 80.
// Run an HTTP request to fetch the appropriate page.
func fetchGoogle(t *testing.T, fd Conn, network, addr string) {
req := strings.Bytes("GET /intl/en/privacy.html HTTP/1.0\r\nHost: www.google.com\r\n\r\n")
req := []byte("GET /intl/en/privacy.html HTTP/1.0\r\nHost: www.google.com\r\n\r\n")
n, err := fd.Write(req)
buf := make([]byte, 1000)

View File

@ -65,7 +65,7 @@ func connect(t *testing.T, network, addr string, isEmpty bool) {
var b []byte
if !isEmpty {
b = strings.Bytes("hello, world\n")
b = []byte("hello, world\n")
}
var b1 [100]byte

View File

@ -468,7 +468,7 @@ func TestTruncate(t *testing.T) {
}
checkSize(t, Path, 0)
fd.Write(strings.Bytes("hello, world\n"))
fd.Write([]byte("hello, world\n"))
checkSize(t, Path, 13)
fd.Truncate(10)
checkSize(t, Path, 10)
@ -476,7 +476,7 @@ func TestTruncate(t *testing.T) {
checkSize(t, Path, 1024)
fd.Truncate(0)
checkSize(t, Path, 0)
fd.Write(strings.Bytes("surprise!"))
fd.Write([]byte("surprise!"))
checkSize(t, Path, 13+9) // wrote at offset past where hello, world was.
fd.Close()
Remove(Path)
@ -688,7 +688,7 @@ func TestWriteAt(t *testing.T) {
const data = "hello, world\n"
io.WriteString(f, data)
n, err := f.WriteAt(strings.Bytes("WORLD"), 7)
n, err := f.WriteAt([]byte("WORLD"), 7)
if err != nil || n != 5 {
t.Fatalf("WriteAt 7: %d, %v", n, err)
}

View File

@ -6,10 +6,7 @@ package patch
// TODO(rsc): test Apply
import (
"strings"
"testing"
)
import "testing"
type Test struct {
in string
@ -19,7 +16,7 @@ type Test struct {
func TestFileApply(t *testing.T) {
for i, test := range tests {
set, err := Parse(strings.Bytes(test.diff))
set, err := Parse([]byte(test.diff))
if err != nil {
t.Errorf("#%d: Parse: %s", i, err)
continue
@ -28,7 +25,7 @@ func TestFileApply(t *testing.T) {
t.Errorf("#%d: Parse returned %d patches, want 1", i, len(set.File))
continue
}
new, err := set.File[0].Apply(strings.Bytes(test.in))
new, err := set.File[0].Apply([]byte(test.in))
if err != nil {
t.Errorf("#%d: Apply: %s", i, err)
continue

View File

@ -42,7 +42,7 @@ func Clean(path string) string {
// writing to buf; w is index of next byte to write.
// dotdot is index in buf where .. must stop, either because
// it is the leading slash or it is a leading ../../.. prefix.
buf := strings.Bytes(path)
buf := []byte(path)
r, w, dotdot := 0, 0, 0
if rooted {
r, w, dotdot = 1, 1, 1

View File

@ -161,7 +161,7 @@ func executeTest(t *testing.T, expr string, str string, match []int) {
printVec(t, match)
}
// now try bytes
m = re.Execute(strings.Bytes(str))
m = re.Execute([]byte(str))
if !equal(m, match) {
t.Errorf("Execute failure on %#q matching %q:", expr, str)
printVec(t, m)
@ -199,7 +199,7 @@ func matchTest(t *testing.T, expr string, str string, match []int) {
t.Errorf("MatchString failure on %#q matching %q: %t should be %t", expr, str, m, len(match) > 0)
}
// now try bytes
m = re.Match(strings.Bytes(str))
m = re.Match([]byte(str))
if m != (len(match) > 0) {
t.Errorf("Match failure on %#q matching %q: %t should be %t", expr, str, m, len(match) > 0)
}
@ -315,7 +315,7 @@ func TestReplaceAll(t *testing.T) {
tc.pattern, tc.input, tc.replacement, actual, tc.output)
}
// now try bytes
actual = string(re.ReplaceAll(strings.Bytes(tc.input), strings.Bytes(tc.replacement)))
actual = string(re.ReplaceAll([]byte(tc.input), []byte(tc.replacement)))
if actual != tc.output {
t.Errorf("%q.Replace(%q,%q) = %q; want %q",
tc.pattern, tc.input, tc.replacement, actual, tc.output)
@ -419,7 +419,7 @@ func TestAllMatches(t *testing.T) {
case "matchit":
result = make([]string, len(c.input)+1)
i := 0
b := strings.Bytes(c.input)
b := []byte(c.input)
for match := range re.AllMatchesIter(b, c.n) {
result[i] = string(match)
i++
@ -435,7 +435,7 @@ func TestAllMatches(t *testing.T) {
result = result[0:i]
case "match":
result = make([]string, len(c.input)+1)
b := strings.Bytes(c.input)
b := []byte(c.input)
i := 0
for _, match := range re.AllMatches(b, c.n) {
result[i] = string(match)

View File

@ -302,23 +302,3 @@ func TrimSpace(s string) string {
}
return s[start:end]
}
// Bytes returns a new slice containing the bytes in s.
func Bytes(s string) []byte {
b := make([]byte, len(s))
for i := 0; i < len(s); i++ {
b[i] = s[i]
}
return b
}
// Runes returns a slice of runes (Unicode code points) equivalent to the string s.
func Runes(s string) []int {
t := make([]int, utf8.RuneCountInString(s))
i := 0
for _, r := range s {
t[i] = r
i++
}
return t
}

View File

@ -444,16 +444,16 @@ var RunesTests = []RunesTest{
func TestRunes(t *testing.T) {
for _, tt := range RunesTests {
a := Runes(tt.in)
a := []int(tt.in)
if !runesEqual(a, tt.out) {
t.Errorf("Runes(%q) = %v; want %v", tt.in, a, tt.out)
t.Errorf("[]int(%q) = %v; want %v", tt.in, a, tt.out)
continue
}
if !tt.lossy {
// can only test reassembly if we didn't lose information
s := string(a)
if s != tt.in {
t.Errorf("string(Runes(%q)) = %x; want %x", tt.in, s, tt.in)
t.Errorf("string([]int(%q)) = %x; want %x", tt.in, s, tt.in)
}
}
}

View File

@ -10,7 +10,6 @@ import (
"bytes"
"fmt"
"io"
"strings"
)
// StringFormatter formats into the default string representation.
@ -26,11 +25,11 @@ func StringFormatter(w io.Writer, value interface{}, format string) {
}
var (
esc_quot = strings.Bytes("&#34;") // shorter than "&quot;"
esc_apos = strings.Bytes("&#39;") // shorter than "&apos;"
esc_amp = strings.Bytes("&amp;")
esc_lt = strings.Bytes("&lt;")
esc_gt = strings.Bytes("&gt;")
esc_quot = []byte("&#34;") // shorter than "&quot;"
esc_apos = []byte("&#39;") // shorter than "&apos;"
esc_amp = []byte("&amp;")
esc_lt = []byte("&lt;")
esc_gt = []byte("&gt;")
)
// HTMLEscape writes to w the properly escaped HTML equivalent

View File

@ -915,7 +915,7 @@ func (t *Template) Parse(s string) os.Error {
if !validDelim(t.ldelim) || !validDelim(t.rdelim) {
return &Error{1, fmt.Sprintf("bad delimiter strings %q %q", t.ldelim, t.rdelim)}
}
t.buf = strings.Bytes(s)
t.buf = []byte(s)
t.p = 0
t.linenum = 1
t.parse()
@ -942,8 +942,8 @@ func (t *Template) Execute(data interface{}, wr io.Writer) os.Error {
// delimiters are very rarely invalid and Parse has the necessary
// error-handling interface already.
func (t *Template) SetDelims(left, right string) {
t.ldelim = strings.Bytes(left)
t.rdelim = strings.Bytes(right)
t.ldelim = []byte(left)
t.rdelim = []byte(right)
}
// Parse creates a Template with default parameters (such as {} for

View File

@ -9,7 +9,6 @@ import (
"container/vector"
"fmt"
"io"
"strings"
"testing"
)
@ -397,7 +396,7 @@ func TestAll(t *testing.T) {
s.stringmap = make(map[string]string)
s.stringmap["stringkey1"] = "stringresult" // the same value so repeated section is order-independent
s.stringmap["stringkey2"] = "stringresult"
s.bytes = strings.Bytes("hello")
s.bytes = []byte("hello")
s.iface = []int{1, 2, 3}
var buf bytes.Buffer

View File

@ -4,10 +4,6 @@
package testing
import (
"strings"
)
var good_re = []string{
``,
`.`,
@ -179,7 +175,7 @@ func executeTest(t *T, expr string, str string, match []int) {
printVec(t, match)
}
// now try bytes
m = re.Execute(strings.Bytes(str))
m = re.Execute([]byte(str))
if !equal(m, match) {
t.Error("Execute failure on `", expr, "` matching `", str, "`:")
printVec(t, m)
@ -217,7 +213,7 @@ func matchTest(t *T, expr string, str string, match []int) {
t.Error("MatchString failure on `", expr, "` matching `", str, "`:", m, "should be", len(match) > 0)
}
// now try bytes
m = re.Match(strings.Bytes(str))
m = re.Match([]byte(str))
if m != (len(match) > 0) {
t.Error("Match failure on `", expr, "` matching `", str, "`:", m, "should be", len(match) > 0)
}
@ -247,7 +243,7 @@ func matchStringsTest(t *T, expr string, str string, match []int) {
printStrings(t, strs)
}
// now try bytes
s := re.MatchSlices(strings.Bytes(str))
s := re.MatchSlices([]byte(str))
if !equalBytes(s, strs) {
t.Error("MatchSlices failure on `", expr, "` matching `", str, "`:")
printBytes(t, s)

View File

@ -6,7 +6,6 @@ package utf8_test
import (
"bytes"
"strings"
"testing"
. "utf8"
)
@ -48,7 +47,7 @@ var utf8map = []Utf8Map{
// strings.Bytes with one extra byte at end
func makeBytes(s string) []byte {
s += "\x00"
b := strings.Bytes(s)
b := []byte(s)
return b[0 : len(s)-1]
}
@ -214,7 +213,7 @@ func BenchmarkDecodeASCIIRune(b *testing.B) {
}
func BenchmarkDecodeJapaneseRune(b *testing.B) {
nihon := strings.Bytes("本")
nihon := []byte("本")
for i := 0; i < b.N; i++ {
DecodeRune(nihon)
}

View File

@ -12,7 +12,6 @@ import (
"log"
"net"
"once"
"strings"
"testing"
)
@ -45,7 +44,7 @@ func TestEcho(t *testing.T) {
t.Errorf("WebSocket handshake error", err)
return
}
msg := strings.Bytes("hello, world\n")
msg := []byte("hello, world\n")
if _, err := ws.Write(msg); err != nil {
t.Errorf("Write: error %v", err)
}

View File

@ -173,7 +173,7 @@ func (c *Conn) sendBytes(buf []byte) {
c.sendPadding(len(buf))
}
func (c *Conn) sendString(str string) { c.sendBytes(strings.Bytes(str)) }
func (c *Conn) sendString(str string) { c.sendBytes([]byte(str)) }
// sendUInt32s sends a list of 32-bit integers as variable length data.
func (c *Conn) sendUInt32List(list []uint32) {
@ -318,7 +318,7 @@ func Dial(display string) (*Conn, os.Error) {
put16(buf[6:], uint16(len(authName)))
put16(buf[8:], uint16(len(authData)))
put16(buf[10:], 0)
copy(buf[12:], strings.Bytes(authName))
copy(buf[12:], []byte(authName))
copy(buf[12+pad(len(authName)):], authData)
if _, err = c.conn.Write(buf); err != nil {
return nil, err

View File

@ -815,7 +815,7 @@ Input:
p.err = SyntaxError("invalid character entity &" + s + ";")
return nil
}
p.buf.Write(strings.Bytes(text))
p.buf.Write([]byte(text))
b0, b1 = 0, 0
continue Input
}
@ -1508,11 +1508,11 @@ var htmlAutoClose = []string{
}
var (
esc_quot = strings.Bytes("&#34;") // shorter than "&quot;"
esc_apos = strings.Bytes("&#39;") // shorter than "&apos;"
esc_amp = strings.Bytes("&amp;")
esc_lt = strings.Bytes("&lt;")
esc_gt = strings.Bytes("&gt;")
esc_quot = []byte("&#34;") // shorter than "&quot;"
esc_apos = []byte("&#39;") // shorter than "&apos;"
esc_amp = []byte("&amp;")
esc_lt = []byte("&lt;")
esc_gt = []byte("&gt;")
)
// Escape writes to w the properly escaped XML equivalent

View File

@ -9,7 +9,6 @@ import (
"io"
"os"
"reflect"
"strings"
"testing"
)
@ -30,69 +29,71 @@ const testInput = `
</body><!-- missing final newline -->`
var rawTokens = []Token{
CharData(strings.Bytes("\n")),
ProcInst{"xml", strings.Bytes(`version="1.0" encoding="UTF-8"`)},
CharData(strings.Bytes("\n")),
Directive(strings.Bytes(`DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"`)),
CharData(strings.Bytes("\n")),
CharData([]byte("\n")),
ProcInst{"xml", []byte(`version="1.0" encoding="UTF-8"`)},
CharData([]byte("\n")),
Directive([]byte(`DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"`),
),
CharData([]byte("\n")),
StartElement{Name{"", "body"}, []Attr{Attr{Name{"xmlns", "foo"}, "ns1"}, Attr{Name{"", "xmlns"}, "ns2"}, Attr{Name{"xmlns", "tag"}, "ns3"}}},
CharData(strings.Bytes("\n ")),
CharData([]byte("\n ")),
StartElement{Name{"", "hello"}, []Attr{Attr{Name{"", "lang"}, "en"}}},
CharData(strings.Bytes("World <>'\" 白鵬翔")),
CharData([]byte("World <>'\" 白鵬翔")),
EndElement{Name{"", "hello"}},
CharData(strings.Bytes("\n ")),
CharData([]byte("\n ")),
StartElement{Name{"", "goodbye"}, nil},
EndElement{Name{"", "goodbye"}},
CharData(strings.Bytes("\n ")),
CharData([]byte("\n ")),
StartElement{Name{"", "outer"}, []Attr{Attr{Name{"foo", "attr"}, "value"}, Attr{Name{"xmlns", "tag"}, "ns4"}}},
CharData(strings.Bytes("\n ")),
CharData([]byte("\n ")),
StartElement{Name{"", "inner"}, nil},
EndElement{Name{"", "inner"}},
CharData(strings.Bytes("\n ")),
CharData([]byte("\n ")),
EndElement{Name{"", "outer"}},
CharData(strings.Bytes("\n ")),
CharData([]byte("\n ")),
StartElement{Name{"tag", "name"}, nil},
CharData(strings.Bytes("\n ")),
CharData(strings.Bytes("Some text here.")),
CharData(strings.Bytes("\n ")),
CharData([]byte("\n ")),
CharData([]byte("Some text here.")),
CharData([]byte("\n ")),
EndElement{Name{"tag", "name"}},
CharData(strings.Bytes("\n")),
CharData([]byte("\n")),
EndElement{Name{"", "body"}},
Comment(strings.Bytes(" missing final newline ")),
Comment([]byte(" missing final newline ")),
}
var cookedTokens = []Token{
CharData(strings.Bytes("\n")),
ProcInst{"xml", strings.Bytes(`version="1.0" encoding="UTF-8"`)},
CharData(strings.Bytes("\n")),
Directive(strings.Bytes(`DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"`)),
CharData(strings.Bytes("\n")),
CharData([]byte("\n")),
ProcInst{"xml", []byte(`version="1.0" encoding="UTF-8"`)},
CharData([]byte("\n")),
Directive([]byte(`DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"`),
),
CharData([]byte("\n")),
StartElement{Name{"ns2", "body"}, []Attr{Attr{Name{"xmlns", "foo"}, "ns1"}, Attr{Name{"", "xmlns"}, "ns2"}, Attr{Name{"xmlns", "tag"}, "ns3"}}},
CharData(strings.Bytes("\n ")),
CharData([]byte("\n ")),
StartElement{Name{"ns2", "hello"}, []Attr{Attr{Name{"", "lang"}, "en"}}},
CharData(strings.Bytes("World <>'\" 白鵬翔")),
CharData([]byte("World <>'\" 白鵬翔")),
EndElement{Name{"ns2", "hello"}},
CharData(strings.Bytes("\n ")),
CharData([]byte("\n ")),
StartElement{Name{"ns2", "goodbye"}, nil},
EndElement{Name{"ns2", "goodbye"}},
CharData(strings.Bytes("\n ")),
CharData([]byte("\n ")),
StartElement{Name{"ns2", "outer"}, []Attr{Attr{Name{"ns1", "attr"}, "value"}, Attr{Name{"xmlns", "tag"}, "ns4"}}},
CharData(strings.Bytes("\n ")),
CharData([]byte("\n ")),
StartElement{Name{"ns2", "inner"}, nil},
EndElement{Name{"ns2", "inner"}},
CharData(strings.Bytes("\n ")),
CharData([]byte("\n ")),
EndElement{Name{"ns2", "outer"}},
CharData(strings.Bytes("\n ")),
CharData([]byte("\n ")),
StartElement{Name{"ns3", "name"}, nil},
CharData(strings.Bytes("\n ")),
CharData(strings.Bytes("Some text here.")),
CharData(strings.Bytes("\n ")),
CharData([]byte("\n ")),
CharData([]byte("Some text here.")),
CharData([]byte("\n ")),
EndElement{Name{"ns3", "name"}},
CharData(strings.Bytes("\n")),
CharData([]byte("\n")),
EndElement{Name{"ns2", "body"}},
Comment(strings.Bytes(" missing final newline ")),
Comment([]byte(" missing final newline ")),
}
var xmlInput = []string{

View File

@ -123,7 +123,7 @@ func pallmall(cols []int) {
fmt.Println(msg)
tot := 0
// wait for all results
for _ = range (cols) {
for _ = range cols {
result := <-ended
tot += result.met
fmt.Printf("%v%v\n", result.met, spell(result.same, true))

View File

@ -41,7 +41,6 @@ import (
"bufio"
"flag"
"os"
"strings"
)
var out *bufio.Writer
@ -161,7 +160,7 @@ func main() {
AccumulateProbabilities(iub)
AccumulateProbabilities(homosapiens)
alu := strings.Bytes(
alu := []byte(
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +

View File

@ -42,7 +42,6 @@ import (
"io/ioutil"
"os"
"sort"
"strings"
)
var in *bufio.Reader
@ -111,7 +110,7 @@ func print(m map[string]int) {
func main() {
in = bufio.NewReader(os.Stdin)
three := strings.Bytes(">THREE ")
three := []byte(">THREE ")
for {
line, err := in.ReadSlice('\n')
if err != nil {

View File

@ -532,7 +532,7 @@ func calc_rows() {
/* Calculate islands while solving the board.
*/
*/
func boardHasIslands(cell int8) int8 {
/* Too low on board, don't bother checking */
if cell >= 40 {

View File

@ -40,7 +40,6 @@ import (
"io/ioutil"
"os"
"regexp"
"strings"
)
var variants = []string{
@ -101,7 +100,7 @@ func main() {
fmt.Printf("%s %d\n", s, countMatches(s, bytes))
}
for _, sub := range substs {
bytes = regexp.MustCompile(sub.pat).ReplaceAll(bytes, strings.Bytes(sub.repl))
bytes = regexp.MustCompile(sub.pat).ReplaceAll(bytes, []byte(sub.repl))
}
fmt.Printf("\n%d\n%d\n%d\n", ilen, clen, len(bytes))
}