test/bench revisions;

* reverse-complement: port C algorithm to Go
	saves 30% on my MacBook Pro and makes it a fairer comparison.
  * test reverse-complement with and without GC (another 15%)
  * revise timing.sh to work on more systems
  * avoid two glibcisms in fasta.c

R=r
https://golang.org/cl/156110

test/bench/fasta.c

@@ -82,7 +82,7 @@ static void repeat_fasta (char const *s, size_t count) {
     memcpy (s2 + len, s, WIDTH);
     do {
      	size_t line = MIN(WIDTH, count);
-     	fwrite_unlocked (s2 + pos,1,line,stdout);
+     	fwrite (s2 + pos,1,line,stdout);
      	putchar_unlocked ('\n');
      	pos += line;
      	if (pos >= len) pos -= len;
@@ -113,7 +113,7 @@ static void random_fasta (aminoacid_t const *genelist, size_t count) {
 	    buf[pos++] = genelist[i].c;
 	} while (pos < line);
 	buf[line] = '\n';
-	fwrite_unlocked (buf, 1, line + 1, stdout);
+	fwrite (buf, 1, line + 1, stdout);
 	count -= line;
     } while (count);
 }
@@ -163,11 +163,11 @@ GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\
 AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\
 AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
 
-    fputs_unlocked (">ONE Homo sapiens alu\n", stdout);
+    fputs (">ONE Homo sapiens alu\n", stdout);
     repeat_fasta (alu, 2 * n);
-    fputs_unlocked (">TWO IUB ambiguity codes\n", stdout);
+    fputs (">TWO IUB ambiguity codes\n", stdout);
     random_fasta (iub, 3 * n);
-    fputs_unlocked (">THREE Homo sapiens frequency\n", stdout);
+    fputs (">THREE Homo sapiens frequency\n", stdout);
     random_fasta (homosapiens, 5 * n);
     return 0;
 }

test/bench/reverse-complement.go

@@ -92,29 +92,41 @@ func output(buf []byte) {
 
 func main() {
 	in = bufio.NewReader(os.Stdin);
-	buf := make([]byte, 100*1024);
-	top := 0;
-	for {
-		line, err := in.ReadSlice('\n');
-		if err != nil {
-			break
-		}
-		if line[0] == '>' {
-			if top > 0 {
-				output(buf[0:top]);
-				top = 0;
+	buf := make([]byte, 1024*1024);
+	line, err := in.ReadSlice('\n');
+	for err == nil {
+		os.Stdout.Write(line);
+		
+		// Accumulate reversed complement in buf[w:]
+		nchar := 0;
+		w := len(buf);
+		for {
+			line, err = in.ReadSlice('\n');
+			if err != nil || line[0] == '>' {
+				break;
+			}
+			line = line[0:len(line)-1];
+			nchar += len(line);
+			if len(line)+nchar/60+128 >= w {
+				nbuf := make([]byte, len(buf)*5);
+				copy(nbuf[len(nbuf)-len(buf):len(nbuf)], buf);
+				w += len(nbuf) - len(buf);
+				buf = nbuf;
+			}
+			for r := 0; r < len(line); r++ {
+				w--;
+				buf[w] = complement[line[r]];
 			}
-			os.Stdout.Write(line);
-			continue;
 		}
-		line = line[0 : len(line)-1];	// drop newline
-		if top+len(line) > len(buf) {
-			nbuf := make([]byte, 2*len(buf)+1024*(100+len(line)));
-			copy(nbuf, buf[0:top]);
-			buf = nbuf;
+		
+		// Copy down to beginning of buffer, inserting newlines.
+		// The loop left room for the newlines and 128 bytes of padding.
+		i := 0;
+		for j := w; j < len(buf); j += 60 {
+			n := copy(buf[i:i+60], buf[j:len(buf)]);
+			buf[i+n] = '\n';
+			i += n+1;
 		}
-		copy(buf[top:len(buf)], line);
-		top += len(line);
+		os.Stdout.Write(buf[0:i]);
 	}
-	output(buf[0:top]);
 }

test/bench/timing.sh

@@ -1,4 +1,4 @@
-#!/bin/sh
+#!/usr/bin/env bash
 # Copyright 2009 The Go Authors.  All rights reserved.
 # Use of this source code is governed by a BSD-style
 # license that can be found in the LICENSE file.
@@ -59,7 +59,8 @@ run() {
 	echo -n '	'$1'	'
 	$1
 	shift
-	(/home/r/plan9/bin/time $* 2>&1 >/dev/null) |  sed 's/r.*/r/'
+	
+	echo $((time -p $* >/dev/null) 2>&1) | awk '{print $4 "u " $6 "s " $2 "r"}'
 }
 
 fasta() {
@@ -78,6 +79,11 @@ revcomp() {
 	run 'gccgo -O2 reverse-complement.go' a.out < x
 	run 'gc reverse-complement' $O.out < x
 	run 'gc_B reverse-complement' $O.out < x
+	export GOGC=off
+	runonly echo 'GOGC=off'
+	run 'gc reverse-complement' $O.out < x
+	run 'gc_B reverse-complement' $O.out < x
+	unset GOGC
 	rm x
 }